Browse the Genome By Linkage

Primer3 Parameters


Product Size:100-400 bp
Primer Size (min)19
Primer Size (opt)20
Primer Size (max)22
Tm (min)59
Tm (opt)62
Tm (max)64

Markers

Total Markers: 2768

ChromosomeMarker NameForward PrimerReverse PrimerRepeat CountBoxer Product SizeChr StartChr End
1CAP01Eccacatccaccagcagacatagggacaacgacaggcaagt18384122932138122932173
1CAP01Sgccttcacatctgacgttgcaagcccagacgtgggagtta1734045571924557225
10002tttgccagctcattatccacatgggctcgagtgttttactgc1640055556975555728
10003ggtgttggatccttcccaaaggccttttgccccataattt1732965247266524759
10004aggatctgcgctcagaaaggaccaggctgagtggagggta2530273227467322795
10005ttggatgtaggcatggcaagtcctgtttcttcccaagcaag1539382744398274468
10006tgctgcaaggttctgatggtaatcagccaacaggctggag2236889141958914238
10007tgtccaatgactctggctgaagcccagccttcacaaagtt1927596878519687888
10008aaaagttggtgtgcgtgcatcagcgtgtccctccctaaac132921001467010014695
10009cgtggcacttcatgtcacaacaatgatcccccatgacaga133091084431510844340
10010atgccccaggctagtcctttccaggtgctttcctttggag153651164842011648449
10011tgaaggatctccgggaaagttttgacttcctgcctcggta153471262011612620145
10012gcctgttctcccagattggtgcaatcacccaagctcccta151761341142513411454
10013tctgtgggctgtcatcatcctcctaggaggggtagcagca173741409107314091106
10014tgaagccagcctgattctagctgggctcccttcatggatac161571507321815073249
10015ttgagccaagaggctcacaagcagctcacaccctgttgtc163471599726715997298
10016tgctctcaaggacatgcacacgtcattgcaaaaccaccat163001688483716884868
10017tcccacctttcccctaatccgacctggtgccaagaaggac191951703659917036636
10018cacaacaggccaggtaacgatgcacacagcatctgtcagg213811802158218021623
10019caatgccccctttgtcatttccaccccaacattcatcctt163951892957818929609
10020atggatgaggacctggatggaccaaggagaggtcgcagag163811981557319815604
10021ccgacctttacgaaggcaatgaaggggattcctgggtttc201102073220620732245
10022tgcctgccttagaggtgtcaagcagacaaaggggaatgga173352110956321109596
10023tcaccaagctgaaatgctgtttcccttgacctcagccttctc153942210334622103375
10024ctctcaaggcagccaggaatgatcccaaggcagggaaaat162562296749322967524
10025tccagaactccaggacagcatcatccaggtgccctcctat153312371345023713479
10026tcagggggtcggtaaaaccgggccctgctgtttcaataa162682459971524599746
10027gccacagaggagtctggtttttgtgctttggtcagtctgagag203162472796024727999
10028gtcacaatggtcaggggacagtcctgcgcatcctttaagc172912562138525621418
10029taaacggtgagtgccacctggaccacccaacaggaaggag163732639428026394311
10030agacctccaagaagccaccatccaagtgctcttgcctgaa214002679059726790638
10031aagagcccccagtacagcaagattcccaggaggactgcac173682770808727708120
10032acaggaagcctggcaaattcgagtgggtggggtgtgtttt192682864020528640242
10033tcttggctggtctcctctccaaatgctgcccggtgtctat193832936444829364485
10034tccttttcccaccagtctcatttcccaaagccagggagta203943019294830192987
10035tggaatacggcaagcctaaaaggtgctgacatggaataagga183993113895531138990
10036aagccacatatgcaatgacacaaagtgagggcctgggttttt203903203071232030751
10037gccgcatgttccaaacaatagggagatgcagtaccaggtga164003278056432780595
10038ccatggaacactgtggctgtatgaatgcccaaccaccttc153803332243333322462
10039cctttgcttctgggcttttgtcggttttccctccttcctt163653424300134243032
10040tgagctctctggtgccacattcgaagtctggagggccata193513495677034956807
10041ccagtcatgaccccatcctttcccaacaacagaatggacaa172673592347535923508
10042tcctctgccttttaacccatgtgctaccaggggacaggagtg183043683286236832897
10043cagccaccccaagatggtattgcaaaccacgatatgctgt152973764687237646901
10044ggctcacgggaaaatgtagcattggggagcaatggaactg153413826287938262908
10045ccaccacccaggagagcttacctcttgccccattctcatc193493924378939243826
10046ccacgtggtgacctcaaagtcgtgtaagttgccgattcgt193374002077040020807
10047tggaaaataggggctccagaagaccagagaaggcaatgaaat151304099981940999848
10048agccccacctcttcactgtcgcaattttggctagcccttg183794198614741986182
10049gtgggcattttgccatctttcctcctgatcaaatgggctta203474290857742908616
10050agcacaccactgccaacaacacgtctccatgcaggtcctt152864389801143898040
10051ctcgcgtctgaatcatcgacgctgaaaggaatggcttgct202354422851244228551
10052tcctgaggccccaagatagatgggacatgcctcactatgg112634441226044412281
10053ggtacaacgtgggtgtgctcggcactgcaaatggtgaaat183984524985445249889
10054ttccactgctgtaggctggagcaaatttgaggatgagtgttg163604582451045824541
10055gcttaagcagtggcatggaatgcagctgggtatttgttgg172874680475046804783
10056tggccattagttccctgtccagcacgaaagattggggaaa183854739540247395437
10057agaaaatcgcccaaccacattgacttcctcatgcccagtg172794825703548257068
10058tctcactggcctggttgctaccgggaatcccagtaattga161864907534849075379
10059tgctaacggatggctgtaggtttaggctgctggcatttca163954995275649952787
10060cttcagttcgggctgaaacccaataccaaatggctgtgcaa203795042801350428052
10061aagacaggcatgcgaaaacaaaggcccttcagaaccaaca183025091773550917770
10062cccactctgcctgaatttccagagatcaccaggcccatgt173025171202351712056
10063cctggcctattgcagtgtcaggtgagatgagtggccttcc172535268276752682800
10064ttgtgcttggctgcagagattgtttggcagccctcataga192695364614253646179
10065tgcaaattcaagctggatggctgctgcacagggtatgctt211955464294354642984
10066gagatgtggcaagggtctccggggctgctgaattatgctc242765535779755357844
10067acactcccattcccagcactcaccacggttgggtaaacct173585621121156211244
10068gttgtcaccactgcctctgctgagcagatgggtgaagcat193775689579556895832
10069caaagttgacccgtgatggaccaaagtgctggggaaagtc193335753361257533649
10070catgcagacagccacctctcaacgtggttatgggctggac172855796974257969775
10071gcccgatcttgctaatcgtcgacgtgctgagaacggtgag151465866512158665150
10072gtgacaccattgggacctgagttagggcaaaagggggatg193615911067759110714
10073atctgcgtctgtgcctgtgtaaggggcgagtcaagcatta201476007140760071446
10074tgctttcatggcaagacacatatgcaggggaagaaacagga173436092127660921309
10075gagcatgtcccatttgtgctgccagctctcagcatggata143946127297361273000
10076tcagaggaggacaaacaccgtaccttcctgcaaccctctcaa163946223748162237512
10077tcgtctcagtgaccaaaacttgtgccctgaatctgtacatcaa152246300490563004934
10078cctttgcaatgtgggcagtattccatgcaaaggacaggtg173306394276263942795
10079tccaattgcaaagctacgagaacctctaccctgccccttctt211976413979964139840
10080ttgcctattccaagcccaaggcgagactggctacaacacg182906457239564572430
10081tcatttggctgtctattccaaactagctgtgtggcaggaagc172036556791465567947
10082ttcccctttcctgtcaatccgctactggcacccacaacaa171976622270266222735
10083tctgggcttgcagcatttagtcggaatttccatgagctttc173936718631467186347
10084tcacacattttgggggcatattgcccaagcatgatattga153906813824268138271
10085cagcacggcatctacacacatgccacaaggaggttgaatg153026908768769087716
10086ccagcccatgtaggtgtgaattaatgtggtgctcgtgtgc153596923769469237723
10087caggagcatgagcgttaccaggatttgttgagccccttga173427017609770176130
10088acccacctttcacccacatcctgggcagcagattgagcta182737103905771039092
10089aagggccactgtggaatgagtgaaatgtttggcagtgaacg193947193888971938926
10090ccatctgcccctccaatttaaccaaaatgcctttccatcg163147248981972489850
10091gacagccacccccaacactaccagtgactctcagccctatca163927332606273326093
10092gccaaggtgcttctgaaaggggtaggcaaccccagtgtgt163147401685174016882
10093ctgcccattggccttctaatgctgtctgcagcaaccacac173967480084074800873
10094tgtggtccagaccaaatgagatgggcacagagctaggcatt173537575381675753849
10095tctcggcctaaatcccaatcgccttggaactccttggttg153857602700276027031
10096aggccatttctcccctgattcaacactgagcacccagctc143837685575576855782
10097gcccctcccatcctcattatatggtgggagtgcttgcttt183417758811677588151
10098gtggggtttggcattatggatctaccagctgtgcctgctc153697855295178552980
10099gctagggtggaggacaggtgaaggcagcttttgggattca223567947769879477741
10100gctccaggctaccagtttgctccaagctggaccattctga163988007948480079515
10101ggcagagcatcccagagtttcccagactgtggtggactca163188083999380840024
10102acgatcccacggttaagtgggttcaggtcccccattacca183418178582781785862
10103tctctcccaaccccaacaacccttctgcccctcacaaact182188272011882720153
10104atgccagtccctcagaaagccacggtggcagacagagaaa203978345546583455504
10105gggcgacaccaaaacttagccaacaagacgacctgcgaac181728418808584188120
10106tcttcccagggggctagagtttttcatttgggccattgct212788499172284991763
10107ccttggaccacgaactccatgttgttattgggcccctctg193738582466585824702
10108cacagttgagggggcttaggatgggggctgcattctcata163448678335386783384
10109ctggcattgctctttgttgcgccaggttcattcctttgga203778769871987698758
10110tctagcagtgccagcaggtcaagagcccatgttcctccaa193068825296088252997
10111tctggtggcatagctatttgaatcaacctggactgctgatga163198915627389156304
10112tcagcaattcaaggcagagcggaacttcccactgctggtc203689003751690037555
10113gctagcgacaggctggagatgcggggattagtttgcatgt232459063761390637658
10114aaagatgcaagcagcacacgcagtgggaacgaagcaaaca163029112039891120429
10115tcagcgtcatccagaaggaatgaaggagcatggaggaggt201659201510192015140
10116gctgcttggacctctgctttcccgggcaataaaacacact162209300773093007761
10117tgtggcttaggcagagaccatcaaccaaatggccttcaga213469392543193925472
10118cgggcttcaggtacacacaactgtgttcagcaacggaagc163579491817894918209
10119agctgttcccaagctcgaaacaccacagcctcggatatga183459590355495903589
10120ctcctggacctccacgtaccggccacgcaattgtaaatga193519679466096794697
10121tgccaggagatctgaggtgatcccctctctgagtcccaaa173979767488397674916
10122ctctgtttcacccccatgctacagacatcaaccccggact173219853343498533467
10123aacccaggagcagagcaaagggtgcttggaaccacacgta213029939396899394009
10124aggtgttcccttcacgaggagggttgcatgttgcaaagaa16383100282754100282785
10125tggtcactccatgggaacagcccattcatgctccctcaat15193101132492101132521
10126ttggccataccctcctcaacgagggtgtgggtgactccat21295102053879102053920
10127cttggccatgtgccagaataggagagtggggactgtggac15384102991591102991620
10128tgacggccctagtgctcatacccctacctgtgggtgtgtt16357103944862103944893
10129ccccatttccaagcagagtcccaatggagagccagaaagg19399104936577104936614
10130ttccatgaaaggcacacaggtgagcacagagggaaggtca16328105907472105907503
10131cacattggggccatcacttagggaagctctgcttgaatgg17303106899074106899107
10132ccatcacccgtttaccctgtgaaggaagcccagatgtcca18385107801568107801603
10133tcccaccaggtgtttgtgagtccaggcaaggaggaaacat20345108569323108569362
10134gttgcaaaggcgaggatttcttcaacgcaagactcgatcc21226109403878109403919
10135aagattgcatgggtgtgtgccgttggggatacggatgact15286110015632110015661
10136taggacggagccctgatgttgtttctccaggcctcaccac19127110577226110577263
10137ccgttgttctgcgggattatgtcccccaggatgatgtgat16296111550243111550274
10138cctggctgacctgctattcctgcttcccgaagaacactga18164112506050112506085
10139tcctcagtggaccagagcaacccaaaatcaccctctctgc16356113117752113117783
10140tccctgcacgtgagaggttactctccccggtggtgtaact16397114066221114066252
10141acgcagaggaaactgggaaacatggaaagggtgcagtcaa20341114700572114700611
10142gccagggctttcatagttgcgaggagagagggcaccacac18216115531172115531207
10143ccatcgtggatgtgaaggaaaaccagaggtgagcacagca19268116232413116232450
10144tctgctgagaagagggacctaacaccacatgggcattagagc16351117227489117227520
10145taaccatgcagtcccacaggtactcgggtcgaaggctctc22331117801479117801522
10146aaatcacacagccccctcactggagtctggtgcaacttgg20395118626239118626278
10147ggccctgtgtctatgggaaaccacagttgtgaagggtcca17216119593422119593455
10148cacccctgcagagtggaaattccaccctggtgagttgttg20364120343540120343579
10149gctgggcagcaaacctttatgctccggactacttcccaaa20318121130554121130593
10150gcgagacgagagtcccacttgaaatcactggctgcacagg16325122005405122005436
2CAP02Eggcaagaacaaggtggctttggctgtccctaccattccaa222268755413587554178
2CAP02Sgaaacaagctggaaacggagatggaagctcccactttcaga1731739692943969327
20153cattgtcgccgaggataagatgaatgggaaggtcttctgtca1738547749614774994
20154tgaaactgcctcccctgacttttcacgaaaaggtgctcca1736157285795728612
20155gccggcaagatagtttccacggccagaaaggctacaggtg1638865398386539869
20156ctgcgaggcaggctctttattgccatcagaactgggtttg1924074108097410846
20157ttgtctggcaccctgatgtcttcaaacctccatgcgtgtc1530382587988258827
20158caggaggctgaggcttaggaagctgcttctgggaaacctg1532991766359176664
20159gcctcccatcactccagttctcgggtgcctgtgaatactg2032296683849668423
20160atttccccacctcccataccctcctccccaggtcagtttg182701063325510633290
20161cctttttgcagcaccttccttcccatcagaccattctaggg203251161419411614233
20162ggtggagggaggcctctaagcacagtggcttttcatgcag153931253802512538054
20163agcaccagtgctggcttacagctgggcttgtccagaaatc211561314451413144555
20164acacggcagggagaattgatcaaacaccagggagggttgt213351395365413953695
20165ggggttccttaaggccacagccaggcatactccagttggtt213991479092014790961
20166agaaaggtcagtggcgaagcatggtcccactttccaatcc183501573913015739165
20167actctgcccatccgaagaaactccttcgcctaggctttga171851654979816549831
20168cacaatccgtgctctcttcgtaggcgggagaagtctgtcc153571674490916744938
20169tactcagggagccacagcaaccctctgtcccaggcaagta153561765618117656210
20170ctggacgactgctgtccaacaccgaggagattgcctcaaa213121829487018294911
20171ccatgtggcaaaatgcttgtgatgctccttgtcccctgac153791914449219144521
20172ctgcagcaatggctcacaattttccccattttctgcaacc192951984650519846542
20173ttccatggacaagctgatggttttggcttctggcctttaca203872068477620684815
20174taaatgccagtgtgggctgtgtgggccaaagcctgtaaaa153212103419221034221
20175tggaaccacttgagggaaagccttgcatacaaaagtgaagca163902139780721397838
20176cgcgctagatgacactcgtcaaggaaaactgcagcccgta181412216229122162326
20177cagcgatagcagtgggatcatctcttttgccacccattca171682286923722869270
20178tagggccagcttcctcattcggatgcatttcaccctggat192812356039823560435
20179tgaatatggctcccagctcagctcagggaggtcagttgct161952452431724524348
20180tgagagatcccgcagtacccccctggactttcagccattc172352537027225370305
20181gtccccattttccatctccaccttccaagatggagggttg183892603647126036506
20182atgggaagcaacgtgatgtggagccaaaatgttgccatgt163602702390427023935
20183ccttgccagatttggtggtttaggctggatggggtgaaac153472791255127912580
20184attgtcatggggtggaaaggttctcagcgggagaggagac173832863458928634622
20185tcccttctcagtggggctaaaaccccacagaatgggtcac193992950954629509583
20186catgcctactcagcccagactcctggtccaaccaactgtg201563046956130469600
20187aggctgccagaaaatgtggtcaacggacgaattgctgaac203783132736031327399
20188gccggtcatatgtcgagtcaaaagagtgttccgcctccaa212553231358132313622
20189agggcaaaacaaatggcagtaagtgacatttccctgctgga163303236523032365261
20190ccccagtgggcaagagtttacatgaatgggaccaagagca204003245330332453342
20191aatcctccatgcccacattcccctggtgtggaggcttatc143953332672633326753
20192acgggacatatgagcggaaacccaatgcaggaggaaccta163313387202733872058
20193aaccgtgacgttgcaaatgatgtaaggagcccaacggtct161593470856634708597
20194acatacacgcagcccttcctgagttcctgccatcctgacc193883553789035537927
20195ccacctggggagacatcattgggtcccttactggcatctg163283643218436432215
20196caggcacaccacacacagaaacctgcagtggttgtcatgg163443740529237405323
20197ttggtctggcaattccttcattgttgactggtcccctgtg154003827869538278724
20198tccttgcccgaatacaaagggtcgggtggcctactctgaa173603926065439260687
20199gagcctcgtctctggctgttccggcttaaggtgggttaca172714016160740161640
20200ttggcatttgtgagggacagttcctcccacagggtgaagt192884097764040977677
20201caactgcaatcggcatgtttagctggcctgtcccatctaa151684181542541815454
20202cccctggttgactccacattgcctacatctgacggctgtg172554219170542191738
20203aggccatggacagacatcaatttcccaggcactggttagc233974307666043076705
20204ccctgctcttactggggttggctcttgcagtgcagacaaaa143074348111643481143
20205gatgctgcaggtgtggagagagagcaggggctaggtttcc182164436815944368194
20206tcctccacccttaggtcctgtggcccaagaactctctggta163934514518245145213
20207ggccagtgaaggggaatcatgcatatttcacaaatgcgcaag162114605343146053462
20208tgcatgtccttccaccctaacggaaaaccagcatccttct173014666811546668148
20209aaacaccaattctttcccctcacccaaatttaaatggggcaag183224758265947582694
20210cagcacagggcatgctaagatatccagggcagatggaagg183974854556248545597
20211atacccctcctgcaagtccagttgcactcctgccataccc233024887522048875265
20212ccctccaacactgactcaacacgccagagagtgccagtaga142654922802249228049
20213ttcttcccctgtgccctctagtaaggccctcatggagcac133515006280450062829
20214gcatccctggcctagtgtttagggtggcatgaaatgtgtg153785103087451030903
20215tgggcctacatcaggcctactctcttccctggatgtcatctt212765161827251618313
20216gtgttcaaacaagccgcagttctaaattcagcaccagctttg231735261827552618320
20217caaggctaccaggtcatctcaggcaccaatcttgtgtaggc193075338805553388092
20218ggtgtgcattttggtggatgcctctgctctctgcggaaat163855434679254346823
20219tggtttttgacagtgggcattcccccgtaatctctgcactc183515527664055276675
20220acgtgggaacatcacagacgtgtctcacccggcagacag223965551275055512793
20221ccggtttgtggtccaagattaatcccccactgctttcctt253045571137955711428
20222tgaaccacctcatcccagtgtaacccagccccaaatcatc231545665391656653961
20223atcccgttttgcatttgacctgcaaagagcgacacctcat152665734920357349232
20224acaggcccaaaatggatcaggaggtcggacagtgggaaag113785773277657732797
20225agaccctgcactcctgcacttgcagtccttggagttgtgc213875858400958584050
20226ctgtccagtcatgggtgcatcggacttgcatcacagcttc193925941933059419367
20227tccctcaagaggggatctgatggaggcaaggtctccctaa212916000032660000367
20228ggtgaggcccatgaatgagtctgaagcacttgggcacttg192346080141360801450
20229tttggaagtgcttgccaattacaagtccacccatgcaaaaa153696169699461697023
20230tgaaccccaacctaccaaccggtccatggggccttttagt173236264679562646828
20231gggcccatctgacctgtatgacccagcccatcatctgttc183846340459863404633
20232tgaaaacagaggcccacctttgttgaacaccccctaatcca172916437370964373742
20233acacgtcctcagccagacctccagccagtttggtcttcg203936515319765153236
20234agcgttgtgggctcatgataatcccgagctgtctttggaa173986613152466131557
20235caggcaatgcttttgagcagtcctccctgtgagcttggat212696710821067108251
20236ggctgggtgcttttatccagccccaccacaacacattcac153776780029167800320
20237tcctctcagggctctggaacagccagctcgaaaatgcttc153566872842468728453
20238ccactgcgctgaaatgagacctcttcctgttccgctgctt153686912307369123102
20239caaagtgcatgggggactctcgctcccttccttcaaacac173947011732470117357
20240tagaggagggaggggtgtgaagtcctgctgccctgaaaag152937078466370784692
20241aagtgctcgcgtgacctgtatgggggctctctgcttttta213727151240071512441
20242aacaccgaggtgctctcacagggactcaggtgaggacgac181577234029072340325
20243ggtggcccaagctaactcacgccctcaccttttgagcact153707332659873326627
20244atggccaagtctgccactttcacgctttccttcaccttcc202167412999974130038
20245gggcctgaggtcctatctccctggggtgaggctggactac163867502925575029286
20246ccatcacgctgacacactgaaaccattaaccacccccaga233457597367275973717
20247ccgaagcacactcaccagacgccatcctgaggctagctgt173457611927976119312
20248cctacccggaggaaggaatcccttcaggacccaagagtgg243917709844577098492
20249aagtttacggggctgcagaaggacgagccacctggtctac193977764685777646894
20250atgcaagtggatgaggagcatgcctaccacccatcctacc212857850790078507941
20251tgtgtgatcggagtgtgtgcaggtgccaaggtctctgagc153167913025779130286
20252gagcctccgagaaggacaaaagaggtgggcagtgggacta233907955984279559887
20253gcctgctgtttgcttgtcagcatgtatcaggggcacagga181948037909180379126
20254gcatgcgagtggttcacattcaccctgctccttcatctcc203848108519081085229
20255tctgtttccagggagccaatgctgggccctatagcatcac183378185122081851255
20256gctcctagggcttctgagcagggctaacactgaggcctgt173338280675082806783
20257gcagcatgaggaccacagtccgtgcgagttcaaagtcacc154008333090183330930
20258ctgagaggcacagccaacacgctccttcttcgacgtgctt172888384755283847585
20259ccctcacccagggactcataatgggccaggatagggattt193668478944384789480
20260ccatccagagttcccctgacttcagatcactcaggcaagaaa153388575286685752895
20261tcagggttcaaggcaaatccctgaccgacggtgacagaag183718616595986165994
20262agtttctgccccgtctttgattttgggaacctgcagtcct173678716261187162644
3CAP03Ectgctacctggccgtacctcttgaaagatgtgccgctgat213419335522393355264
3CAP03Sgagtaccgcagctgacatgcggacgaaaggcgtaagaacg1840034357123435747
30265ccaccccgattgtttagtcctccagcatgtattttggtccat2138442990384299079
30266aacgcatccccgtgtctacttgaccccagctatgtggttg1715649852104985243
30267agctctggaaatgggtggaatgtgccagcaagaagcaagt1737756941685694201
30268accagcaccaccatgaacagcctcgactgggaaatgggta1934861326266132663
30269ctgcggtgattgagatgctgtgaagtgcctatcccggtgt1930767964976796534
30270gctgcatcatgtggtttgtttttcgagcaggacttttgaacc1736276988297698862
30271gcttcggggacttttctctggctgaattcaccaacaccatgt1627086254768625507
30272cggcacctttcttctagctcaccaagaccctggtggcttac1526888645808864609
30273tcacccaggtgcatttttgatcaattgttatgtgaggggaaa2037389020658902104
30274ttcccagaatgggcagtacagagggtttggggatgaaaca1434593979799398006
30275agtggattccctgcatttggagtgcctggggttttcttca213241022946010229501
30276gattgtgactccttgtgtgcagaatgcatcactgtggcaagg163001103616011036191
30277gcataggtcatggaagcaacccattgtgccagaacaagacaaa183671127669511276730
30278ctccattctgctgctgatgcatcacctgctgccttcgtgt153401185759511857624
30279gaaaaccctggactgacatcatcccattggtggatggatagtg154001256222412562253
30280catgggtctggctcatagcacgatccttccaaagcaaagg183831355734413557379
30281tcgaggatgctatgaccagaaatgcgtgtacacacccaatctc182701453902714539062
30282gtctcttgcctgggtgttccgtgaaatttggcagcgttga193651528318215283219
30283gggggcccaggactacttaccctgaatcaccaccacctca152221582447515824504
30284ccaagccgaaagaggaacacaggggcagttcctgatcttg183561669139316691428
30285ggctaagcacgagtgcctctggcactaattgcatcccttg182681762083917620874
30286ccgctgtctgaacaacctcacgaccctctggagaccaaac183021855141518551450
30287tgctgtcagggtaacatgtgtgtacaatgtgggtgggggatt203031954494819544987
30288atggcaatttccagccttgtcaggcttcagcaggtttcct183472004960420049639
30289ccaaccccaaaaaggggtatgcatggatggggtgtcataa163472073629120736322
30290accacatttattaagggcaggaatgccctttcaccagcatct163212158631821586349
30291tccttgtgggggagagaatttgaagcctccccttgatgtgt262862252331922523370
30292attggaacttgggccagctaagccaagagcacctcaaagg193742339487023394907
30293cctttgccaagagccagagtatggggaaaggcaatggtta183622432355824323593
30294caaggctgataaaccatgagtgtgaaagatttcagggtggtttt192532510578425105821
30295cccttttaatggggctgacatggtggcatgggaagataca173792592178325921816
30296tgggtgctcttcatgacctgaaacgagatggccttccaga183722688658926886624
30297atcgcctttgctttggcttaaaacacccaagggtgacagg173352758197027582003
30298caagatggaggctgagagcatttgagtgccaaaacagcaga253402850315728503206
30299attgcagatccggaggaaaacaaggcttcaatgcatgacc191882895610128956138
30300tgcatgaacattgcctttcatccacctcacgaggagaaca163942991548229915513
30301agaggggtgcccaggataattccgaaaccaggctaggaaa203253082538230825421
30302gccacactgggcagtaatcagtggtgaataggccggagag191363170537831705415
30303agcccctccagctgtatgtcgccacgcacttatctctttgc183413255128732551322
30304atcgggtttttctccccattatgctttgggcaaaggtgtc153773345524433455273
30305cccaaaatgctgcctgataaagcgcatgactcccactgta183433379569233795727
30306gtgagtgcccagccatacaatccatcatgcaaacagctctc193683466258234662619
30307tcctcaagggttctggaaggttccgagctgaactgtgtcc182723517112435171159
30308catgcccatgtctatggtaggacccgggaatgttaaccgata163623586683335866864
30309ccacaattctagccgggaaccaatttccccgatcctacca173953674717336747206
30310tatcctccaaggcctccagatccccatgggaaaacttcac151793772530937725338
30311tctgggaaaatagcaacaacaatttcaatttggttgagcatgg223183813024838130291
30312ggtgggctatgtaaggcaattttgtttctgaagggctgtttttc143833910944039109467
30313ggtgggcaccttctggtaaaatttgtctggcatcccttgg153763975703839757067
30314actgcagctgccaagtgaaatctgagtgagcgcaaatggt233364050696840507013
30315tggaaggaaatgagatgctgaatattcaagccagccacgaag172914142338041423413
30316ttggagccctgaagaccaatatcccaaagggtgtgaatgg162134226035142260382
30317ccgaatttggtgcaagtgaaccctaaacttgggctcatgc171724306968943069722
30318gtagtgccccagccagaatcggctggggaaattgtcaaaa193474388523443885271
30319tttgtgacaactgccggtctctgatcccctcaaacggaag153024481471444814743
30320ttgatggaggagggatgacacagctgcttcggtgtacagg182404563372145633756
30321ttgacccttatgccccaaactgggggagttatggctcact161544656665046566681
30322ggatttttggctggagcaataaagacttgggtgcctctgc184004748112247481157
30323tttctccgggggatatgttgtgagtactgctggtggtgcat163514840787648407907
30324ttgctctggagaaattgcacaccagaaccagagaaagaaatgg152974921688649216915
30325ccccggcctgtaatatgaacacacgcagagcaaagtcctg202685002370750023746
30326gccatcgtgtgtgagagagcggatggcctaagaggcacac161715065488250654913
30327cactctcacgcactcccaagcccaggtggttgttggagat213285162243751622478
30328ccccttgttcccaattttcacagctggcagtccaacaaac172725217959552179628
30329tgtttgcttcccatttgtttggcctggtggaattcctgtgt193615309827753098314
30330gctaggggctgcagaaattggcagtcctgctttctctggaa183965408461354084648
30331aacaccgctgtggaggttcttcttgcgaccttactgaacttg191845502746555027502
30332gcagcctcaagctagggtgtcatgcgtcttccgtctacca252095600775456007803
30333gcttagccagtggtgtgctgggcggcagtacacaattcaa153745687083056870859
30334cgcaggcacaaatctcaaaagcattgaatcctggctgtga213725738971357389754
30335agcccaaccctgagcactaacgcctgccactaagcatgta172375835468958354722
30336gggaatgtgaggcaccatttatgaagccaagatgcgtgtg213585891632258916363
30337gtcatgtgaagggggctctcaggctttggaggacgatgaa243645971333559713382
30338tgggcttttctgcctatcgttgctagctctgccagctgtt153246063892360638952
30339accctgtcgactcccagaaaatatgaatagcgcccgatgg161616144310561443136
30340ccagtcagctgcctccttctctgcgactcacccagtgttc201946240012862400167
30341gcaatggctcagcttgtgtcaggtcggctcatggagttgt153166299762362997652
30342tgatgccccttgactacacggattcccagagggcagtgac182876384795763847992
30343ccaaacagggacaccacctttgcctgtgaatgccaggata153416428121464281243
30344gggtaaccggacactttggaagtagggagcccatgtcagc193586519681065196847
30345gatccaaggctcacccactcccgggttccctctttactcc173716603809266038125
30346atgccactccaggacctttggacggcttgttcctctccac173956668562766685660
30347ccaaatcaccacatgagtccattgaaaagcaaggagcaaagaa173446743741267437445
30348caattccccttctccccaattccttgagccagaggtgtga173896842453668424569
30349ggatgggctttttgcaggtattttgagaaatggctccagtga183066913102069131055
30350gcagttgtgctgcattaggccattagggaggtgggttgga163307006231470062345
30351ccctcatctcaggattaccaaacatacgtctctggggcacct162997075134370751374
30352caccatcctgcagtgaaagcgcatttgcagccctctaggt152407156685471566883
30353ctttcatcccaggggcaataggggcttcccaaactttacc183157217589172175926
30354tcagctggaagggactcacagggttgaaccacatcgtcct103947279238072792399
30355gaccttggagcttctgggtttcaacatgtgtgagggaatgga182547376023473760269
30356gcacactgcgaccattgtttaccccaaaactccctcaggt203837470050574700544
30357ttctcgatttctccccctcacagcttgggtggtgtagcag153217549963075499659
30358ccccagagactagtagcccagatcctctaccacagccaagca163887581629475816325
30359acaaagggcagactcctccaaggcccccacttatcaaggt183747661876676618801
30360ccaggcgactctcaaggactcacccagcactggttcacat173297731606477316097
30361tcccctgccatattcctttcgcaggcacccctaaggataa193777822710578227142
30362ccctgtctgaccacctttcccacgcatgacaggaatttatgc152227919619579196224
30363atgccccaaataccaagcactgttaaagtgggccaaagca183768011696180116996
30364atctttgcggggagggtattcccttcctatcccccagaag153438037578380375812
30365gcaggtactgatgtccaacaccccccatgttgagtattcatggt143988125596381255990
30366catgtcaggattcccaccaaagccaggcctgacactagga192568202932982029366
30367gggacggggattatttggttttttcaccatgtccttttcagg183348293646182936496
30368ccacagccaagatatgcaagccacatgtcccatcaacccttt163668390915983909190
30369tcagcttcaggcatccacatttgctggacatcccattgtt183758475872484758759
30370caggacaaaagggaggaaacatcaatgtgaataccagccaagg192848573666185736698
30371cctgacttggcactttgctgtccctcttgctggatagttgc153818667334386673372
30372ggggctaacacgcaacgtatgggtgctcagtgcaagtctg153668748225587482284
30373agagctgccttggaaagtgccctaagacaggccgaactgg202048843420888434247
30374ccgggaaatctatgctgctctaagccaccagctccactca152488885945188859480
30375aatgtggagttcagggagaagtaggacctggggagagtgaca153708969122189691250
30376ctgcttctccgtctccacctcacgtggtctgctcttccag182799044007190440106
30377ggcacccaatattagcgaccttgggcctatggacagtgtga163609140086691400897
30378aaaaacgatgaagccggagattgcttgcctctggatgaga223579212399392124036
30379tgtttggtgctataggcaagctgatccattccctgtcacca153469279274292792771
4CAP04Ettcacctctgcccctcactttgccccatcacttccataaa183109122638191226416
4CAP04Sgggaaggttggtgatgtggtggaggacttaggccctggac1937731540603154097
40382ttatggtgggagacctgaggacaagtgcccctggagtgttt1635941357344135765
40383cctgcccatcggaatcttagagttcagggccatggagaaa2229550054225005465
40384gatgcatcagattgcccaaaccgggaagacaggaaagatg1538158983595898388
40385tcccagctgccctctaagacaaggctgccagcttctgttc1539468610846861113
40386ggtaaccctgggctctccttgtgcctgtggctctgatgac1536278454197845448
40387gcacagtgagcagggttgacatgggtttggccttagagca1525186073758607404
40388aatgctgcttgcccaagaataccatgattgggcatctgtgt1525995156969515725
40389aacaaaacaccccaggttcggttgtccatgggggaagtgt191791039357410393611
40390tctgcaagatagccctggaaatttttccctccagcgattttt183561092367810923713
40391ggaagatcccagaaacagacaaggagatccatgctggtccat233011187635111876396
40392aaaggaagtggggtgtcatcatccccacacatctggaaaca163891272373512723766
40393cacactgttgcacagcaggatgcactcccaatgtttattgc151961359752213597551
40394agcaaggagtcagcccagagccaaagcaggcttgtgaaga222691441045814410501
40395cagctggccagaacattcattctccccatttgctgacctt171971509600715096040
40396tcactcctgctctaccactgaactggtgccgagttaccaaca153751567738815677417
40397ggggtatcacaatggctggtccgatccatagcctctttgc161141639574716395778
40398cgtgctgaaacttgccagagctgcaattagggggatggaa203711724592317245962
40399ggaagggacagaagccacactctcccaacttccagcacttt203781813063818130677
40400cctcccctttcagtgcctttgatacggtgtcccccacact193081911005719110094
40401ggtcccactttggtgcatttccactctgatgtgaatcccaag163131948591519485946
40402tccaaaggctgtgaccttcagggcactcagattgaagcaa223802042677820426821
40403aagaactgcctttggctctgagccaaaggaaagagacccact193552128341721283454
40404ccagctggctatggcagaaggaatgggggagcattgtgat181432202623922026274
40405tctggagaccagcgaccttttggcctggagaccttaccat163752271438322714414
40406cgcagctcctggcctattacgcccgtctgacatccagag163162364405923644090
40407ggtgactgccaaaggctagatgatctcccccaattaagcaa152192436899624369025
40408cctttccctccaggttttccccagggcactgagggttaaa152652507658825076617
40409gggaaagctcatggaagtggaggaggaaggaagggtctgc193922594941825949455
40410ttgttaccgtgttacccaatgcgggccctctttggcttatct213252629898626299027
40411ttccacattgcactcttgtggggcacatatttgggcctgtt143262657313126573158
40412tatggaagcccgatgtctccacagatagggtgcccaggtg112742699835426998375
40413gcatgtgcccgtaatatccaggcttaaggccaaattgcag183562795081127950846
40414atcgactgcaaagctgctcaagtacagacccagccccaga163302869959228699623
40415ccttccatggccacactacaacactggggataagggagca163222941024429410275
40416ggatctcggcaggtttgaatctccagatgatcccgggtag193563016293530162972
40417atgcccaagtgaatcccaacgcagagacctgaggctggtt173733113677031136803
40418tgaggaactcggggagctaagcagcacgaagtcacaaacc183693206296132062996
40419aagacgccaagtggattgctcctcgctgttccctcatttt163833303494733034978
40420cccaggcttgtcctgaaaacacgctcttcgggttggttta153793397957433979603
40421accccctactgccctttgttcctgactcaccaggcctacc213603471168334711724
40422ccagttcctccatgttgggtagggcaattccagtcaaatcc202373553602535536064
40423ttccagcgttcctctcttggctgaacccacatccgctttt163953618227336182304
40424aaatgtccgacgagtgacgactccccgtctctcattttgc153303712746837127497
40425tcacatggaggcgcaaatacgcttcgcatgtctgaagcag223283774300037743043
40426cagtgtaagactgggatggtgaccaaatcaaatcccccagag132503849650938496534
40427cgtttcccattctcaacaaccgacaatgctgggtgtgttttt183163892602138926056
40428caaatgtccaacagcctccacatagcggagtccagcacag173523975393839753971
40429gaggcctggttcatgtaggctaaggttcagccctgcgtct213344040761340407654
40430gcaccagctgggaactttctgggaggggagcatcaagaat152764138616441386193
40431acagggcatacggctcacttcatctcctccctgacccttg152374203392142033950
40432acccctccctcaaggaatcaatcgtccctgctctggatgt153224296935742969386
40433tgaaggaagagttccaccatccgcctcttttgggagatgcag193664379381343793850
40434tcttcaggatccgcacacagcagcgtgagagatgggaaaa183034478022444780259
40435cgcttgttgccaagtgaaaatctgcctgaatgagggtcag162944547807445478105
40436agccaaccagacattgctgaggaaattttcgaagaggcaaaa153224641273946412768
40437ccattgcccggaacattttattttgcccccactctagca154004727416847274197
40438ggctatcctcagccacaaccctcagcccatcacacctctg162254821345948213490
40439cttattcctgggggttgcacaactgtgcacctgcctgtgt182964894451448944549
40440gtgaacctaaacgggcttggaacgctggcaattttagacca173534971664349716676
40441tgaaaggtgccacaaccatcttctccagggatgggaaaga153925067224650672275
40442cttgctcctgccctcttgattgcaataggaagccatgtgaa183415157733151577366
40443tcagcagtggctgaatgacagcctacctccacccttttcc153375240096052400989
40444tcctgagtctgcccaagacaaggggaaagaaccccctaca191295336661553366652
40445tcccgctatctgcctcatttagcttggtttgccccataga173715421723054217263
40446gataatcggggacgcaggtagctgggccacataaccttgt192335491773754917774
40447gagggcaaaggaaaacaaaccttcctgttccatcccaccat152785569401255694041
40448tgtgtgcccatatcagtcagggatagtggtggccgtgtgag163555664760956647640
40449tgctgtaccaaggtggaaacatggctgatttggcaacaaac172285714017057140203
40450atcagggacgccaactcaatgaaagtggctggcctgaaag153135808007958080108
40451cagcaccctctgcttcacagttcttccccaggacgtgagt193215865276358652800
40452tcatcgcaacatgcacactcgtgcttggcaatgacggata153985959115059591179
40453catcctgcgggttttagctcgtatagggggaggcggaaag153886048730860487337
40454gacagggccataagctggtcacaggagggaacgtcatcgt203586128654261286581
40455accccacttcgaggaattgatcctccccagaggcttattg203686207288962072928
40456tggaaaccctccaggtctgtaccggactcaccgtagtgct153036270241262702441
40457gggaaggcacaaaacaggagtgaaccaaaaccctccttgg173926344460463444637
40458ttcctgcgtggaaagtgagagaccctcacacccctcaaac152556435697064356999
40459ctggggtgtcccttttgtgtgaacccggagagccctctat303756489790364897962
40460cgtgaacatcttgagggcagtggtgtttgacctcctgtgga163846582701765827048
40461gggtggggagcagcatattagcagtcgtttgtgctcttgg223736679816366798206
40462cccctccaccacaagtgattttgcaatgggctttcacatc153586748764267487671
40463tggagcagttccatgggatatcgggagaatgggaagacat162466830328168303312
40464tgggaggttatcatggcgttagctgcaacgtgaggatcaga213626906222269062263
40465tccactagagctggcagcagccagcccctagtgttccttg183866991474869914783
40466agagagggtttggccctagcttggtcctctggatgtcgtc173267074544170745474
40467cgccctccttcttgtgtgttgggctctagatgctgggaag183387132255671322591
40468tgtgtacctcgcaaaatcacggatgatcccccaaccagaaa151287231916572319194
40469catcagcaccgtacccaagaatcatctcccatcccacagc203947321081773210856
40470cgagcagagagggggttagacaaggggaatcaatccctca233757416578174165826
40471tcaattccggatccttcgatcaaccatgaacgtttgctca193467500563575005672
40472ttgctctggcaggagtttgaggcccaagagttttcagcaa192507592731875927355
40473gctgcaggcacacaataagcgcacatagcacccctctggt203717613888876138927
40474gagaggggaaaccagcacacgtgggtcagcctccaaaaag222857712035377120396
40475aagcactgccttccacaccttggggttccagtccagttct172887793194977931982
40476tgcaagtgcagaatgagtgggaatgagcccatgtgtcagc203257888537878885417
40477aaggacaccagtctgggaagttatgctgcagagtcccttcgt152847967767979677708
40478ccagctgaaggtggtttgctgtggaaaatgcaggcttcgt152188063398080634009
40479gcgtaacgatggcaaagacagcccaaacccaactgaagag162638155073881550769
40480cctttctggtttctgcagcttttgggttatgtctttcccaacc183998224356782243602
40481gcaggcaaatttcagcagtggtcctcccaggactccctct161298315284183152872
40482cccatgttgcagcactattcaaccaacaacctcccatgtcc173298403109784031130
40483atgtgggagggaagcagtgtaggacgctgttggtgtgttg153038493493284934961
40484accaaaaactgaccccaggatgcagataaatggaaagcagtc152968548772185487750
40485caaatttcttcggatgcacaatgctaacgggtgcgtagtgt183978636941086369445
40486ccggtgaaaggtggagagactgccacagcataaggggtatt172868733078187330814
40487ccttggcagagagtgtgctgcccagagtagggcagaagga162868750952787509558
40488ccgtggtcatatgcaaaagctgtcctgggttgttattttgct142878836270088362727
40489gttaatatccggcgggtgtgctgcacagctgccttctcag163828928362889283659
40490tcagacaaagaggggtgctgacacggctgtaagcctggat153819011698590117014
40491ccgccatttcaattttgtgagaatagcttctccggtcagca221309106431891064361
5CAP05Ecagggtgcatccactcacataaattttcctgtggcccaac173009181370891813741
5CAP05Sggacattcgatggcacaagaggtcatgccactgggttttt1823331327343132769
50494gaagctcggtccctttccttcgcaaatcagattgccagag2021639721703972209
50495gccagacctgtttgggtctcgaccccaatgggaaatcaga2125248753984875439
50496ttgagtcaccatcccttccacagccctcaccacattgact1537458020205802049
50497tacattccgggaggaaccacctagccccatgtgtcaccaa1721067762516776284
50498ccactgctcgtgactggtgtcgggttggtctctgggtaaa1926274204627420499
50499accctctccctctgcaacagctggtgagccacatccacat1539883362838336312
50500gctggtgagggctggtaaagtccaagtcatctgggtgtgc1739091765589176591
50501gggcagaggagaagaaagcacatcagaaccgccaaacaaa151021002396710023996
50502tcgtgtgatgcaccaaagtggttgagcatgcgtctgagga203581094268110942720
50503agtctttgggcagcggtttatgatgctcctggaatggaga222811181337411813417
50504tccagcgggatgtctaggatctctcctggagggacagacg162761264205112642082
50505ccttggaggtgctagggaaaattgggtgaggcaattttgg143781319071413190741
50506acagctgtggacttgccagattcaattgctccccatctcc163181402977214029803
50507gccctactgatggtgcttcccgcagccatatctcaggtca183591488504314885078
50508aaatgtgcctcccacggatactcctcaccacgctctcctt183881584192915841964
50509tggcatcattccaacagaggtcccagaacctcctcttctcc201731663275416632793
50510tgccacagagtgggaaacagtcaccaccacctcatcttgc193991747757417477611
50511gcctcgtcagagtgttcgtgctggtggcatgtgtctggtt153251788956217889591
50512ctgccacaaggtgtcagaggtccccctcacaatgcctaac174001869069518690728
50513ggtgcaaagcctgaaagtccctctccccacctgagtggtc162901910324719103278
50514cagaggtcctggtgctccttaccagatggggcaggtattg173451995828119958314
50515tgcagctgatgatgctttgaagacaaggacatggccccta152572086954820869577
50516acatgcatggatgggattgatgccagaaatgggattcctc193352182315321823190
50517aagtcagacagccgcacaaaattgcaaggcttccctgtgt173582276713722767170
50518catgctctggttccccagatagtcaataaccatgcccagca202042358698023587019
50519tctatcgccaggggattacccacttccccgggttaaaaca172602445397324454006
50520gcatcccctgcatttacctcgcaccagatgtggacaggaa153702503938625039415
50521cccttgatgtgggatccattacaggccaggtaacgcttgt153222596146825961497
50522atatagggggagcccaggtgttctgtcatgggacgtcaaaa183852684484226844877
50523tgccaaccggtgatgtaaaagctgccatgtgttttgaagg141712778710827787135
50524cctggttggagcaggagagtctgtgttgggagcatccaga161912830500328305034
50525tgctacatccccgtgacttggttgggatacctggggtgaa183532886686328866898
50526ttggcacaatcctgttgcatggtttcatgtgcagcgctaa192932953578029535817
50527caggccaaagaagactggagattcccaaaggcgttgtgtta183763034849030348525
50528gcagaaccagcgaatgtcagcactgactcctcccatgcag212863119485631194897
50529tgccactgctacccaacatctgcaacccatttttgcttgt182503217787732177912
50530agccaagtttgccctgttgttgccttaaattcccattcca192773257634732576384
50531gtggcacagtaatgcctggacctgcgactccctcctctta182933341921133419246
50532acctttcatgggttcctccacatggctgctgtggtttctc232933437247534372520
50533gggctattccacttgcttgccatgacggctcttcaagctg173913498990234989935
50534gaattacagcctccggcttgaggctggaaccttctggaca183323566510635665141
50535agcggcacatcaggctaaatcaatgccaccacaggacatt152173661786736617896
50536accaacaccatgcatccgtacctacagccctggtcctcac151173760741437607443
50537agaggcacaactgctgtggaggcccctcctctattgttcc153983828943838289467
50538ccaaagaatcctttcgggttttgggaaatgcagtgggagta192433920027939200316
50539ggaggcctttgtcccaagtttgtccctgcgtttcagattc204004014577540145814
50540cagtgtggcatggaattgctaattgtccccttcctgctga191224106501341065050
50541gccactcgaggaaaagatggcggaggaagcatgaggaatc182624199774341997778
50542tgccaatattgccctcactgccaggtctttcctgggcata233204289776242897807
50543gaagtggtacggaggcttggctgacctgtgggtgaagtgg182984366861543668650
50544tgatagcagagcccctccatgggcagatcacaagcctagc203614459284344592882
50545aggcccagagcattccaatacaggtcatgtggtcttgagctt163904554034445540375
50546tgcaagtccttggcaaagttgcagtcccttttggaggaaa163774653767546537706
50547ctgacgacagcccaattctgggggcaaggagacatggtta172644743373047433763
50548ccttgtccctgtcagcttcctccatgaatatggggattgg183424835338348353418
50549atggcggggaggaataaagtcacgtagggatggtgagcaa153714933121949331248
50550acgccaagcccttgatagaggctcactcccacactgttgc153425029092550290954
50551ggctgagacttggcacaatgcaagtaggagggcccagaga152355124816151248190
50552cttgccttggtcatcatggagcagagacctgcacaagtgg201545206869452068733
50553agaatggaggcacgaaccatttgtttgaggttgggtgcag161395266542152665452
50554atttggacacccactgcacatgcatgacctatggctccag172745270323252703265
50555gaggagactctgggcaatggttcatccagctggggaaagt142735320484953204876
50556ctccactgccctccaaaaagggctggtgccgagaaattag173685395429753954330
50557tggcattcctacgtttgtggtgctgtaggttgggttgtgc162665488973854889769
50558catttcctggggacgaagaagcaaagtgtttcccccagac183615570981855709853
50559aatctggccaagcacctgttctatccgggcacctctgaag173695653472756534760
50560atggacgtgcctcaggagatgagccccaggctcttaggtt163445750642657506457
50561cactggggactggagaaaggccagcctccctgaaaatgag202025816298858163027
50562tcccaagtcacatggacaccccttgctgttttccctgaaga193185900939859009435
50563cctgaagaccggggatcataagctcagggcatcaggtctc173505923102659231059
50564ttgccttgccctctactggtcctgctctctggttcctcgt152925977237859772407
50565cgctggtttgaggttgttcaattgggctaggagccagtga143136055870460558731
50566ccggaggtttctatcggtgtcatacaccggcctccttctc163416107240161072432
50567atccattcaccctggcattcctggccacccaatatccatt183786195436961954404
50568catctgggtgggaggtgtttgtcttacccttcggcactgg223636277036762770410
50569agagcaagggtgccatgtttttgaccgctgactcccctat153146299409162994120
50570tcacactgtccccagctgttgaaccagcagggcatacctc132646395632463956349
50571ggggatgcttgggactgttagtgctggaggaggaatttgc173756494026364940296
50572caggccctgctccataaaagcccagctgagcagacatttg183796582078765820822
50573ctcctcgggcatgattcttctgtgtggtcccattttccaa171976640656366406596
50574gcccacccagacatttcttcaagccattccccagttacca183346698939266989427
50575gtgtggtctggccttccttcgaagcagagtggtggtgcag173346777089267770925
50576gggtaacatctgccgtgtttgcacgttcttcagcacgttcc203576849307568493114
50577atgcagaggtgcagagtggatcacacataaacgccccaag162016948792269487953
50578gtgaggcatttgcagacagcggctgctctcatgtcatgct203887036359270363631
50579tgggaacaaggctaggaggactcctcactgctgcgtatgg163137114538471145415
50580caggctggaagactcatggacaggttgcaactccttgtgc183587173436171734396
50581tcctcaaaaatgcccaaaccgtgcctggcattgagaagag183517267295572672990
50582accggtcgacaatggaaaactgaggtctcgcagggacaat193797357008573570122
50583cacctggcattgaggtgagatcgatatcacccgtggtctg222907453099174531034
50584gcggtgggagatttaactgcgtttgtgaagtcgcctgtcg153807542608675426115
50585gtggtgacccagatgatccacccctgggtgttgcagttat191407585607375856110
50586gacacccaggttgcagacaagaagcaggcattgtccatca202537645363876453677
50587cagccctgtcatgaattggacccagaaatttgatggtgct223907744435577444398
50588tggggtctagaggtgcaggtcacagcacacccctgttcat182937756880377568838
50589ggggcaccaatgagtagaggagccaggagtggaaacctga142887856318278563209
50590tggtggggttatggatgtgattagccctctaggccgtgaa193977868352178683558
50591tgggtatgaagctggttgtgatcaacccagactcacaatttgg143697924418879244215
50592actcatgcatccatgcaaccgcatgtggcttgttctctcg193228018354380183580
50593acttctccagcctgcctctgacaaagccaggcactgttga192848109971281099749
50594ttggtagatgcccgtgtgtccccaatatgggcctgaggta182958209189982091934
50595tagcagcttgccctgaatgagattttggtgtgcggtttca193868294955382949590
50596actgtgggccccttttacctgcatcagccttgtgtgcttc181868364684983646884
50597tctgagcccacagaagagcaatggggcacctggtgttaag183368461147584611510
50598atgggtgcctgatgtgactgacagccgatctggtgctttt153788551901685519045
50599caactctggaggctgcacatgtctgacgctctgccagaaa193578642234886422385
50600cccaaattctttcagcaagtgatggtagccttgcagggtttt183768732915787329192
50601tttcacctcgtgtgccaaagtggcaactggtctcttccaa173738831799788318030
50602ggcccttagcacatcccatataaagggcagcgagcatctt182098925676889256803
50603catgcagttcccttttgcaggacaagccttcccattgagg212448993833789938378
50604gggaacaagtaaacccctcaatgaatgttgaagacacgagagg193749088047890880515
6CAP06Eccatggacatttcattgctttctccccatcccctaatcatca163797891839178918422
6CAP06Stgtcctggtcctgggtttctggaagctgtgcacaccagag1837647984394798474
60607ctagagctgtgctgcctggagccctggagtgtgaagtgtg2339357831995783244
60608gaagcattggcattcaaccaaatttcccaaaggggagagc1835767441916744226
60609ctgggctagcagagctcacaacagccagggatggaagaaa1927272211417221178
60610ggactttggcacccagaaagatgcaatgcagtggaaatgc2129381493808149421
60611tcctaggagcccttgaggtggagagggcgtagggtttgtg1534490594239059452
60612cctgcaggcaactcagacaggggctcctcatggaaacaga1633498075169807547
60613cagactgtggcctcctttccgtctctatgccctggccaac243961032512410325171
60614tcaggtaccaggaggccaacaccccactccatggacaaac213421108006911080110
60615ttcaaccctgctcttgctcactcaggtgtgcccttgtctg193391191795811917995
60616tctgacctgcctccatttcaccatgcgatgtagtgtgcag193151266035912660396
60617cacaggaaaagcccacaggtgccaaatgtttatttgctctgg202971327832613278365
60618ccattccctggacccactaacccagtgcttggagacagtg181931380918113809216
60619ggggaaagaatggagcatttttgctggctgcatcattgta183511445384814453883
60620ggcaagagatgccttcaaccgggagacggatcctgtgaag173161531661615316649
60621tggcacagttttcgaggagactccttggagggacacttgg182611612430016124335
60622tggaggagcttcatgtggtggcatggacaaagggcttctc213711688983516889876
60623tgagggaggcagaatgaacagggatcgactcggtgattgt142901755067117550698
60624agtccagcgtgctgatgtgtgcccagatcaccaagacctc152091791372317913752
60625gggtgtggcctgtcctactccacttggtgcagaccctgag163841848960718489638
60626ggtgtggaggagggactctgcttttgtcccaaccctcacc162781911534319115374
60627accctgactgcaccttggtttgaacattcccgctcttcct163802007555620075587
60628gtgggctggcttctcatttccaacgtgatgaacccaggaa182572069719720697232
60629ccccctatcctatgcaccaacctcctcctgacagctcctg193752167749521677532
60630gctgggtccttgggattaaactgtccctacagcgcttcct192422202056922020606
60631ccttgggatcaggaaactgcgacgaagctgacaccctgaa202682297058222970621
60632ccctgccatttgagcttagggacttccgtgtccaccaaca183092391988823919923
60633gtccctcagtttgggattgggcgccgagagtccctctta183652471892124718956
60634cccttcacctgcactgaacagctgtaggcagcagagacga203832518970725189746
60635actgggcagtcctgagggtatctgaagcccagcattagca173062604909026049123
60636gcctcggtttaccaggtgagactcacaccatgcccatcag152732683330826833337
60637ccagacttggggcttttgagaactccgcgaacgacgatac153892778870527788734
60638ttcacccaagccctgaaaacttgggtattggtgcctttga153812873895028738979
60639cccttcttaagcccccgtagttccatggctcccatttagg153702953100129531030
60640acagacaggcccaaggagaagttgccgagtgtgaagcaag153693046630130466330
60641tgtgtttttgtcgccttgctccttgtgattgccatgtgct203043144820031448239
60642ccaccagcgtacatctggaaggcccaaactctgacacaca202613222620932226248
60643aggacttctcgcctcctgtgggccctgtgagaacttctgg191443310365233103689
60644ccttgctcttatggggcttgactggtggggtggaactgag172693409878134098814
60645ggcggtactccctagctgtgtctgggaacggaatccatct202993499336834993407
60646gaaagcaaggggaagtgcatcaccactccccaccgtattt203413598846935988508
60647ttgcctgacactggcttttcagggagacgggggaacttta183883669336336693398
60648aaacccagagttccccacctaacagtcacccccaacttgc213033728167537281716
60649agcccaactccagagtcagccttagaggggtccgcacttg203493824435038244389
60650tggcattggatcaacaccatggtttgttccccttgggtta193013922816039228197
60651cttccaatgggagcaagacctttcaggacagtggggaacc152433956411039564139
60652ctgccaacacacattggtgacagctgggtacgggtgtgta163764052373040523761
60653agcgcagagctagagctggaggaagtgtcctcgggctaga213044135880541358846
60654actctgtgcagcctcctgtgcacaggcacaacactgacca163734226531742265348
60655ggaagagaagccagtgagggtaggtgatggcagtgatgttgaa193824290077042900807
60656gctcagcacatgcctaaacgctgattggggcagtgtgtgt182254369615543696190
60657gcagactgaagcagcacacaagccagtttgggacccttct203214441983444419873
60658aggttgattttgcccctcagtactggaaggggagcaagga202704478982944789868
60659agctttcgggtccttccattccaaatagcaaacacgcaca163484552859045528621
60660gctgtgcttgcctattgcaggccatttcaatcagcccaat153904652408146524110
60661ggggttctaagacggttgttgcctgccttccacacagtgac173454710299747103030
60662ttggacttgttggcatccatggcctttcctgcttctaggg173984781419247814225
60663ggcttaggggtgttgtgcagacgctcacactccagacagg152844874432948744358
60664acgttccgtaacggttcagccattggagaaagccatttgga192804970719849707235
60665cgggggattgaatagtcaggatgatcccctcccaacacat173155051442250514455
60666ggcactcctctcccatgaatccaaagcacattttcaaaccaa173765146206351462096
60667tggggcatcttgtagttccaggccctcatgttccttcaac181125245735452457389
60668tgcttgctcatcctgctgattcccaatttatgggcatggt163425318688953186920
60669tggggctctttatccttcctgaacttcgacattgggggaca181745412176254121797
60670agggcctgatggagatgctatctgctgagtgatgcctgct201965471009554710134
60671ggccagaggggattattggtggactgggagtccatgcttt192695544167655441713
60672caggcacgcatacaccctaacacggaaaacatccccattc193465643764656437683
60673ctctgttcccagcctcgtctaggcctccatcaatgtgctt172395696995656969989
60674agcggcaaaaatttgaaccatgccagcttgatctgggata193485788764557887682
60675tgagagaccacagccttggaggggagctgtagttgctggt182895881845958818494
60676ccgaatctctgggtttctcgagagccccaaagtgcaagtc172825974598859746021
60677tcccatgccgtttaatttcctcgcagagctgactgctagg193716017575560175792
60678gcaccatgaggtctgaccaaaggcgggctactcctttagc153306096143160961460
60679gaggctagatttccagtggtgatggtggcatacagaggatgg202076191814861918187
60680ggtatccagaatcaggcagcatttcaggttggctcatggtg153966281383162813860
60681gggtttaatgggaggcatcagagtgtcagcacagggctacc223796366042863660471
60682ctgagggcaaaggcttatggggcacagaacgtgggtacaa173986463556364635596
60683ccggccaccagatacaatttagctgctcagagccacactg163906554075565540786
60684gtgtttctcggcccatttgtggggatgaagcatgagtgtg153726642200166422030
60685agcctccctgagtgcttgactaagtgtgcggctgaggtgt173636739802167398054
60686aggggcttgcttgcattctatccctcacacaagtaccacga152506831825468318283
60687cccaaggctgacactgttgacactgcagcctccatcttga153816931293069312959
60688gcctttgcaatgaaacaccaggggcttgaccttatgcttg162947029596870295999
60689tggtgagttgtggagaaatggttgaacacatctccggttgc172117102906271029095
60690cacctccaggactgggtctcacgtcacaggatgccaacac161947200166772001698
60691tttgtgcaggtcaacagcagcagtcacagtgcaatggtggt173567289645572896488
60692cctcactgacaggcatttcccaacagttgccgaaggaggt183857355894573558980
60693caccagcaaaaggcaatcacgccacatgaaatgaaaacctg153777431447874314507
60694ttcggggccttcttgttaaagccagttgcactcctcacag193837500588975005926
60695tgtgacagccccgagagttacccatgaaaggtggagaagc173357595245475952487
60696ctatgcccaccacagggtttgaaaagccctatagcccctga182007687078576870820
60697gcagggaaaggagggttaggcaagctcttttccaggctgtc221857773016077730203
60698tctctgtccagcccatctgaattagggccgattcaaagca153887859597978596008
7CAP07Ecccactttcaagctgggtttaacccagaggcaaccaaaga182408285606382856098
7CAP07Stctaggccaagggatcaggagcatttacccagcacccatt1931650842705084307
70701tctcacaacatccccttcgttgtggcccggttttattgcta1530057273735727402
70702ctatggtgcccagagcttcctggctcgtgcaatatcatgg1539067265816726610
70703cggattccttcatccttccaccaaatcccaaggcaatgat2223676377547637797
70704ggcatgtcaacccaggagattgccaggcaagctagttgaa1939185912618591298
70705ggaatcagagcctcctggtgtacatgcctccactccatgc1936795360379536074
70706agttgggattccatgctgctaaggagcccctatcccaaga172681044926810449301
70707ttccagatgtctttgccacaagtggcctgcaaaagtagcac183161126760011267635
70708ccgtgtgacagaaggagcagtggccatcataaggctgttg153161215845612158485
70709ccaagtgcccccatacagatcttcttccccttcactctgaaa162911313284213132873
70710tcttgcgctgcttttcagtccatcggctggcctacctaga202391405377014053809
70711cccccaactaccaccagctaagtcgcatgggatccaaact193621485334014853377
70712cgtggtgtcgaacagtggttagtggcacagccagtgctta202681562458715624626
70713ccacggaaactctggcaaattgttttgagccagggaaggt203121657979816579837
70714ttcttgagagtttccgggtcattccttgtccagctttcggta182951744578017445815
70715atggccctttctggaagtgacacatcctgctgtgggaaaa223141828048518280528
70716tgcccttgggtatttccatctgatccagtggaggctctga153051924718419247213
70717cgtgcaggagaggtgatgaggggctctggagggtacaaca172972002807620028109
70718aataacgggctgagcaggaaagggacactgcgaggtctgt203252052448620524525
70719ctcccctactgaccggagttaactgggccccaccactaat153552134279621342825
70720catttccatggcaaagaggatgcaacttgagcagtgagca193642180859321808630
70721gctcaccatgtgctttgctcgaggcctggctttaccagtg193432280653622806573
70722ccacaagctcagggcaataatagctgcaggccttgatgag213852340621723406258
70723ccaacaagaaacccaaagcatgtccccaaactctctggcta161452411291024112941
70724gcctgttggacatggcttttggctgcactggctctctctt153602492072324920752
70725cccaccccatactccagctacatgggggtcaggatgatct222692577523025775273
70726gaccacccaggtcacacaaatatcccgagggctaaacctg183702676334826763383
70727atcccaggccgtgtgataaagacacgttacctgccctcaa152542735251127352540
70728acccaagaaccccatacacgtctgcagtcaggtttttcagga143612771073327710760
70729gttggtcttggcccaatgtttcaagcaaaggaagccaccta153732862596228625991
70730ccccctgttggccactaataccctacccctaccgtgttga173952924225429242287
70731gccaagaccattgtcaagaggccaaaaccacacaacgagga162313021116330211194
70732tttctgcccctactgccttccccttccatagaggccatga152603079211530792144
70733tctgcattgtttgcctttgctctctggtgcctggaaatga162513159374531593776
70734accagagcacaagaggcacaatgggctggcttcacctaag163273243574932435780
70735aatcggcaaaacaacccaagatgaagcctttccgttttgg171293293328132933314
70736gagactccccaaaatgtgtcaggggcctcaaaacatacgaa223773371968733719730
70737gtcaacccagggtagcttgcgaagctgactccaccgactc193233450428434504321
70738ttcccaacacttgcatctcggaccgtcctgacttcccaag192943541154035411577
70739gccaaacagcagggactagctggagtacttggccacctga161893635582336355854
70740ctcctcagtgctgcctgaaatttcacccccatcctttctc193373706434937064386
70741gtcaggaggaccgagtgacctgataaccctcctccccaaa151883756963837569667
70742cattggccagaaccctgtttccacctacaggtgctgcaag183013817533538175370
70743cggtgacagtctctcgatgccttggggacggtcctaatga213143915833739158378
70744tatgcagcaaaatgcctgcttggatttgctcatgcctttg192933963725239637289
70745gttccccagggtgcattagaggataaggcctgccagcata132184063668840636713
70746cgtattgccctggtgtcagacggaaagcaatcaggtctcc152844156929641569325
70747atacacccgtgtgctcatgcccttctccctgccactatgc193334237222942372266
70748aggccctccatcagcatttattgcctgagaatgcagtgtg163484333107443331105
70749accagacgcctacccagtgtcccaacttccagaggcttgt153914425889544258924
70750acctgatcccactggcttgtccgacgagcaaggaaaaatc172894518031145180344
70751atgctcgctcagtctgcttgaggaagggggttgcagaaat162514612808246128113
70752ctcggaggctttttccaatgccaggcattcacaaaaactgg153534704525747045286
70753tagcccaaggaagcagaagcatgacatagggcaggggtgt173004757783347577866
70754aaggcccttgaagttgaggaggagggatggaaagggtcat212234845488548454926
70755ctggggctcataccctcttgggggttgcccagatttgata152184931554449315573
70756tgggccttggctacctattggtggggccggataatgtcta183475013985950139894
70757gcaccccatgctgtcactaaagtgctcctgtctgggaagg153885098612250986151
70758gagcccatggagtctggaacatggggtccacccatgttag173705195007451950107
70759tgatttccagccacctcagatccttcaccaagggggtaaa192405292264952922686
70760tggtcaatgtgcgtcatcaatttttgagtgctggcccttt213685365100853651049
70761cctgccagagctctcctgatcaagaaggaaatgcccaagg211435448397354484014
70762ggaggggcttcatgaacaagacctgctcccatgtttttgg173725547989455479927
70763ccagttgtacggggatggttgtggcacgtctgttctttgc163975612865256128683
70764accctgggcatagtctggaatggccttcagctcttccatt153235693681256936841
70765agagaatggggccagaaggtaggggttcccactctttgct153665771928857719317
70766tgattgcgtaatttttcctgtccatgctggtaccaaaccaga182915866169758661732
70767gcagaccccattctggagagggtaaatgggggcctgaaat173235950935759509390
70768ggctttgccacctcaagtctatctcctgggcctttgttga233926042442460424469
70769tcttcgttcccacacaggaaccctttcgatcttgtccctct193116117937161179408
70770agggtcccacagcctaacaattcaagattgccaggaccaa162686198705861987089
70771catttgtcaccccttggtttttcaacagggctctttctgagc153726281209962812128
70772ggtgtttgaccccagctctcttccttaactttcttcccagca202416373045863730497
70773gcagcaggcagcagtaattgctctcccagtcgcagcaag261616472271864722769
70774ggcaggtgagtgtcaaatggtcgtccaattttcatcctgct193436499842264998459
70775caggaggagatccgattaggcggggcacaataatggagcat151546589685465896883
70776accaagacccacgcttatggtgccagagctggctcaatta163516620180966201840
70777gaactctgccctcggatttgactgcctgccactgtttcct182656701382667013861
70778cacagccctttacgtggacatgaaaagtgaccgcaccatc182416759473767594772
70779tccaacagtcccatgagtggtcgtggtggtgaaacattcc162866859051768590548
70780gctcccctgcttttagcaagttgtgagctttctggcaagtga193656958674669586783
70781gcaaggatgtgtgacccaaagcctaagtgagggaaaggttg163567043293570432966
70782cccacaccagttggctcatatgccaaaaggacacatgagg153067068349370683522
70783cacaccatggactaccagcagactgctggtctgccctaca182837097597070976005
70784tggagtgggagacacaatcgcctggcctgcatactccttc143197181503671815063
70785cacgaggtctccctttctcgtaggcctgaggaatggctgt183717256504772565082
70786tcctggaacaaccaccagaatctgcctcaactaggcagcat193467332415373324190
70787tcaggacacaagcacaccctatttccctacgtccaccaagc172157401666074016693
70788agcaaattcccagcaggtgtttgggcaagaactggtttga172137494092874940961
70789gccactgttcatggcaggtatgcaatcagtgaaccccaac193897583329175833328
70790tgtgggatgttctcccagtttccacctgggagacctcttgt183887680253876802573
70791aagcaaacaccatcccaaatgtccagggaacaaacctggat152777774851877748547
70792tccagtggattctggttgtgatcaggctgaattgggatgtg153847872720278727231
70793aacagaaggcacccaggagagatggatcggagccgtgtat223707970097679701019
70794gcttgcccaactttgcctacgcaaaatggcctctctccac193658061684980616886
70795catgcagcggaacagagattagccacatgcatgcttcatc193328147112981471166
70796tctgcagcttaggggacacacaatgagcaatgccttccaa192928200357982003616
8CAP08Eggctcccaacggatatgaaacaccatcacggcatagagga162127715040977150440
8CAP08Saaggggcgctatacaagttgacctgtggaggagggatctgt1840054769505476985
80799ctcaggtcgtcatccagcaggcctgaggagcaggcttaaa1822362775446277579
80800tggacactccaggcactgttgcctttgctccagctgatct1935971208377120874
80801tgagttcacccccactgatggggagcccctaaatccaaag1637981076598107690
80802ccccagtagacccttccaaacctgccacttacccttccag1516587531128753141
80803cgatgctccaggagaaagaaacagcttcctaagggcagtgaa1624796676919667722
80804gggatagaggcatcccaatgcccacctcccatctgtcaat163881001644210016473
80805gcagctctttccccctttctaaatgccccagaccatgaac151711099699510997024
80806gggctggtttgggtttatgaccacatttctgaagcacaagtc183001193597811936013
80807cccaaggatcctccacagacgtggtctgccttccttttgc172721244020912440242
80808actcaagccccagttcatgcgctttgggaatgatcaagtcg173541323244413232477
80809ccagtgctcacagggtgttggggggaatcggaagaggtta152831411945714119486
80810ccccactcaccaggcagtattggcactcaattgcaagacaa173061507532115075354
80811gtgcacccctatgttcacgagttgtgccttccctccaatc163811558386215583893
80812ggcaaaaatcaaagaggcaagtccccctaggtctacccatgt202751652009316520132
80813gggatcctgccctactttccagctggcccgacacttacat222831695997316960016
80814ctgaccgtacccctccactctgccagcttgctcaattttc192681794560517945642
80815ggggaacaatagggctgtgtgcccttgcttctctgctctc152641893927718939306
80816ctctgttgaagccccagtcccttcccatggccttttcttg202091978103119781070
80817atggtgggaggatttgcagtttcactgccagccagctaga152732061788420617913
80818gaacagttaaagctgcccatgttctttctcaggaaaagggttcc163702151447221514503
80819atgagcttggtagggcttgctctagtgcctggacggaggt152522223639322236422
80820tctgcttcccttttctctggtcttccactgccatggtaaatct192372280585522805892
80821aagccatcagctcacagaaatccttgtgccccctagtggaag153232342156823421597
80822cccatttaaagccccattccttgctggccttattctttcca152552435876124358790
80823gcaaagttcagcatgaaagcatggaaagatttcccagcaatg183172483859724838632
80824tgtttgtcccctcacgttcaccatatcaggcgtcccactt192992535878825358825
80825cctgcctttcacggtttttctggtttagctgacatggattcg171092607534026075373
80826ctggccccttaaagccttcttggtgtgcctcagggttttt193602704521927045256
80827tttcttgcctgtcctccaaaaatgcatcacggagcatcac162622780175727801788
80828gcagaggaccacccactacccctggcaggaagctggtaac233482878465828784703
80829tgattccctcccctctttgatagaggcactttgggccatt143032901646929016496
80830tcccagttttctcccatagcatggcatggactgagctgttc203692988631729886356
80831gcaaccagaagccaacacacgcctacggactctccaacca213973065139430651435
80832aatgccaactactggcaccttggggccacagtctataggg172503146316431463197
80833tccaactgctggaggacaaacaaggcaaagcccacaagtt171103243042932430462
80834ctttcaccgcaaaccatgaacggtggatctggagggataa153983319563033195659
80835gattcctgcatcagccatgatggaacctgcccagactctc173933409837834098411
80836aaggtccccgaggagttaatgtacatgcttggatggggaca163413507181935071850
80837taatgaaaggggtgggcagttggtctcccttggagatcgt212233597071635970757
80838ccagcctggtttcactttctgtcaccccaattgaaaatcca153873695563236955661
80839gcaccaaatgggttgacgtattgccactcctgacataggc173763793686437936897
80840gccttggtgtaggagacagaaatgcagaaagaagccaagaagg181653873509838735133
80841accgctgccaagaagatgatccctgccatttgattgcttt153913965803739658066
80842cggaaatcagagctgccaaaggccgacgcatgtatctttt152654041196340411992
80843tgcattttcttgtgtggtccttatcaatggctggctgactga182494140915841409193
80844tgtcagccaaggctctgaaaactcaggtggcgaaaggtgt172944217232742172360
80845aggatcctcggggttttgatggtggggagatcacctgaga183924281008142810116
80846ggtcattatcaggctggtcacacgctgctatggtcttcaggtt212874379184743791888
80847ctggccagccagacgttaagccagacatgggtgagcacat153514478119844781227
80848atgaatgccctttgccaatcgcctccccgatttctttacc151884558205645582085
80849gagtgagggcaaacatgctgtcatggcacccagaccaata203164647802946478068
80850cattgctttcagccaactgcggcctggagaccttgtatgc163474735694647356977
80851cgcatggcagcatgatttaccacctcccacctctggctac193294818402448184061
80852ttttgccccaccaaaacaattccagtccctgatggtttcc173304903773849037771
80853agccctgcgtgcagtttattacagctggccttctggagag163604992644749926478
80854cctcatgcatccttcaccaaagcagcagtcccccaaaata163285088535950885390
80855ctccctgggtcagaggattgtggcctgtctgccagtctaa181025148412451484159
80856ccctgctcaaagtcctgcttacagccactgcatccttcaa163045244428352444314
80857gcacagctctggaaaatggagtgctgccagggtgattgta182755325518253255217
80858agagggcttggagtcacgagtccaaggtcacaacctgaatg151605410568854105717
80859gaccacttttgggccaactctcatggacatggcagtcctc172845504430855044341
80860cttgctcaccactggcatgtcaggactgctgcccttttct152455591139855911427
80861gatcccaactgcagagcacatcctggcctttcctttatctga222095674634956746392
80862gacccctgtttgtgggagaaggatgcagctgctgttagga163915758993257589963
80863tggcccctagcatttccttaaaaataatgaatgggtgcatga163205799390157993932
80864atgctgctgcccttttgtttccaacgacagatactgccatgt172695871270358712736
80865gcaatgagggtgcaaaacaatggagatggaatgcatcctg201705964333059643369
80866tttttcccacttttgtggaggtgggcagttaaacccaaacca163536056890360568934
80867cttgctggctgggtaaatcaccccaccagccagagatatg153556150633161506360
80868tggtccccatagaacccaaatcgatggagacccagttgtg153266240642562406454
80869gaaatcggccccattacagaaattcgtcctccggaacctt173746340229863402331
80870gttgaatcggcctggaaatcagggaagaggggaacttgga163796424938564249416
80871tgtgacccaccagaccagactccatctccgctgggtaact153716514202465142053
80872tcttggactgggtggtctgatactggaacccatcccaagg183526586314765863182
80873gagggccatcacctctcttgatgctccctcacttcccaaa203476668558066685619
80874tgtcccggaacagagtcaaatggcctctgcagaataggtg153746762918367629212
80875gtgctcatgcgccatattgtctgagtagcctcggcagctt192916862661368626650
80876cccctaggaaagggatggagtgggatacccattgtgtcca163966954353069543561
80877agggtcctgctccgagtcttacacaccgggcatcttctct183137022336470223399
80878gggacacggtcctgcttttaaaaccaggccacggtatttg183337104437571044410
80879acgctgtcactcagctgtcgcggacccaggattttctctg181997141031371410348
80880cctaagatgttggccattcgcaagcaacacgttgggagaa172207238086972380902
80881tgccagcaggagtggttacagggaggcctctcctgaactt212827327851773278558
80882tcaacgtacacaagggttccaccccgttcaaaccatgttg212717411968674119727
80883aagaccatgaggtgcccactacacgcagtttcacggtgtt162827433145274331483
80884ctgagggtgtgtgagccttgaccaaggactcagcctggaa151587469433174694360
80885tgctcacacaggcacatacgggcctcccaggtaaggaaac92307509852475098541
80886gaggagcatgccagtctgtggtcacgggactgcagagtga111717571820275718223
80887ccctggaatagctggatgctggacaccgtttttccttcca184007645757476457609
9CAP09Egctgcctcttttccagtgctgggaaatctctgccctaccc163775339970953399740
9CAP09Sgacctcacaggcaccagaaaccactctaccgatcccttgc2027335586663558705
90890gctcaggcctatttgcatcccgagtttgagggcaacacag2136245390894539130
90891tcccttcacagccctcaactatccagcacgagcaaaaggt1632155257985525829
90892cgttgggggagtgaatgaatggggacggagtgtgagaatc1639760126146012645
90893ttccatcagcaacatgtgaggttggacccatctcgttctctc1621067608896760920
90894tgtgtacgggagagggtgtgcgaccctcatgtacccccta1826477603197760354
90895ttcccagagaacccttgtccaggcggcttatctgagtgga1536886706448670673
90896ccatcctactggtcacctgaaaaacccccataattgcgtcac1915296662729666309
90897ggggtccatgacccataagaattggtgggctccctgtatg1629598129099812940
90898caccctgcattgaaaggacactgatcggtggggtgttttt142291044939910449426
90899ctgtcagcctttccctcaccggcctgctttgtccagtctt191771105537411055411
90900gctcctggggagagagtcaacttatccgccaaggaccgta193751200686112006898
90901ccaagggtcgaggtcaagtcatcccagcagcaaggattgt153461284649512846524
90902cagttattccccgccttgtccaacaagaggcattgggtca193071370941313709450
90903gggaggccacagagtggttaaaaaacaggaatcccccactc163211451510414515135
90904ggctgtcaaccctcaagacctccttcctggctgagtgtca183331540905915409094
90905agccacacagcaagtctggacatggtctccagcgactcag223091630206116302104
90906tctggaaagatgaccccacagcatggacctgatgatgttga183931730193317301968
90907tgtgggagggtagcgttcttatggtgatgggtgcactctg181841821344718213482
90908tttcttacccttgcccgatgggcaggggattgacagagag153261919785119197880
90909aggctcaagctgcaaactccgcaggggaaggagggtattt163632018497420185005
90910cctttgcttcatgggcaactgccctgtagccaggtcaaac183032055309720553132
90911tcctcctccatttctcactggccagaaggttggcgaatgat153782150886121508890
90912tctcacaggaccaagagatcaatcaggggcatcagtatgcag203362211333822113377
90913tggagaatgattgcccagtgccaccttacacagccgacac163752302436323024394
90914gcctttggccttgaaaagaatgtgctctttaggggccagt183012395851623958551
90915ccagatgaggtctggggttcgctgaaacggggagaatttg183222485491224854947
90916ccctaatggtcccagcacatggtggtcgggctataggatg163622570899425709025
90917agcagtggtatggggtccacgttgggaacatggagcatca143172664871726648744
90918gtcccctgctgaacttctggtgcccaaacttggaagtcct162582746422927464260
90919agccaatggatgatgacagggacacccttggccatgactt173882822878028228813
90920cccttggggaccacagtatctgggatttgtgccagtgtgt153482914341129143440
90921gggatccatctcatcattccaccaaaacttggcagctcctc153783010633830106367
90922atttcattcccacccacaggaggttggtgggtgaatgtcc181623040551430405549
90923atctgggtgccatgactgtgccaggaagcctgttcaaacc152353134307831343107
90924tgcttcctgctcacttctgcctcaaagaccttggcccatc173373233625332336286
90925ccctctttttcaccccctgtaaagtgcagcccaagtggtt152313329859233298621
90926gtcttctgcccaccagatcccaggaaagggacgacaaagg213443422046134220502
90927tcctgtttgcggaactccttgtgcttgggctctgagtgtg222743471408934714132
90928acaggaggatttgggagcaaaggggctgagctactgcttg121893535557235355595
90929aagcaagccttacggaagcaccctcttctgccgatttttg283513613562036135675
90930tactgcccctccgtctcattgcacgtttccttttgcactg143233686034336860370
90931gctgcctcccaaaatacatgatgccaaacatggctctctgt153353766780237667831
90932ggctgccaggagctagatgtcaattcctgtgcccctgttt173373841113238411165
90933aagctggccagaggtcatgtccctgaggttcccttcaatg163513939479339394824
90934gaagtcaggcacttggtggatgaagcagcaaatggacacc203804033833240338371
90935ggaggagaccgagctgaagaaacctccccagagcttcctc203214093371340933752
90936gtggccttcatcttcccttgtttcagcatggatgctaccg223754153367741533720
90937ccactgggggcagagaataagctggtgagcaaagggaaag192484176782341767860
90938ctgagcctccccatctgttctgctgcttattgctgggaaa123434269420242694225
90939tgcctcccttttctttccaattgtatgcacccccatgtgt171024310740943107442
90940cacagggatgggacttgtcatgaccagctcaggaggaaca161274399501143995042
90941gagccagagtctcaggattggaatctggctcacggcttctt242874477255844772605
90942gtaggccaggctttctggtgggtggatgctgagggatagg173454569341745693450
90943tgctcattctgcatgggagtacccctctcacaggtggaaa213234668772546687766
90944cctgccagtgcagttctttgtcttgtcagtgctgggcatt183964766022847660263
90945tgccaactgggagacagacatttgagaacccacgaaagca173294852971148529744
90946gtggtgatgcaatgcctgatagctgtgtgacctggggact183824923005649230091
90947aggaacctgcccagaccatactgctccttggcctgcttat172035012103450121067
90948tgggtatttgccgcttagaaagtaatggggcagggaagaca183775093679550936830
90949ttggcaggattttcaactgcggcccatttccactatctgc243375182134551821392
90950cctttggctccaaaaaccactcagggaggggaacttgtgt202445267172752671766
10CAP10Egcccactgaccagattaaacgaaacaggtggcaagctcgat171527076667170766704
10CAP10Sgtcctggcaagggcaaattaacttggtttggcatgtgtgc1515331695433169572
100953ggactgaaggcaggcaattcgagcagagaacccagcccta1936133654513365488
100954caagtggaggggatctgaggagtgggctgctggctaactc1925242317214231758
100955ggacctggacgacccatttaccctcagtgcaccaaaatca2026951084815108520
100956ggacaagcccacatctctcatgcggtgaaaacacactatgg1813459953975995432
100957tgtggagatcctacaacagtcccaagggaccagagaaaaacaca2138269516746951715
100958tggactctccacacacaagacagagaggctgcttgtggcttt1914178879237887960
100959aaggcctccataaggcacaatgcgcatttattgccaacat1830682646018264636
100960gaaggacccaggtgctctgttccacaaagcgttgatagcag2037291840209184059
100961cctctggccgtttgcttactaggacccctcgaaggagaag193971002493610024973
100962ggcttcctggtctccacaagccataactctgcccccaaag193041062764510627682
100963ttccaaggacaccagcagaagcacatggctggttctcaaa182901149499311495028
100964acgatgtcttggcaaccagaggagggtgctacagggtcac173251168298711683020
100965tcaggcagtaggacgcatgtctgcttccagctcccacttt152861256578912565818
100966gtgctgctagatgcctgtggcacggacactgggaaatgaa183951337052513370560
100967ctcccctcacacacattccacgttggtgagcaagaccaga173761427659414276627
100968ggcaagttttagttcccttccacaaagagaaaatgcctggagtg153081519229815192327
100969cttttcccccagtgttgctctggaaagaaggcagggatgt151911609368416093713
100970atccaatttgccgatcagttgctcaaggggaaaaagaagga163981707675817076789
100971tccagaagaaataatgggcaattttgcacttgccaaaacttagc192341751427117514308
100972ccccaggaagaaagagctgagggagcccaactatgagtgc142801755885117558878
100973ttcttggtgcaaagggaacactccattcgaatcccaggtt133501831915118319176
100974tggccattcaacatctcctcgcggagtgagttcaaatgtaga142361879776818797795
100975gaattggacctacgccctcatgggtgtaacccacctctgac143491907533519075362
100976gttgctgcggtttacatccagaaggcaccagtgtcagcag232951999913419999179
100977ctcccttcccctacgagcttcccgaccttagtccccttct172812080312320803156
100978catgtctgaggtcggtccaacgaaagcactggctcatcac152192170692321706952
100979caagacccgttctcccttcatccttgctgatcccagtcct253842260100222601051
100980gcgctgaaaccacaagtcacgtgggcaagggaactcactc213952357414923574190
100981tggcttcgaggtgaattcctggtccagaccatgaccttcc152932451600424516033
100982gagccccagaggaggaagatcactgagcgaatgagccaac243692550456325504610
100983acctccttgcacttcctccacgcatagcaaggaacatcca153792622729726227326
100984aatcctgccttgccccttagggcgtggtgatgagagttga193712674930326749340
100985tcttctttcgggctccagtgcccattccactcctcctctg212582760406327604104
100986gcccaaaaaccctggagaattggccccagctcatatatcc154002842564728425676
100987tttcccgaggggtgtgttacttttggccagcaaacacttg203022929444229294481
100988ggagctcagcaaaagcacctcagctgccatgaagacttgg222812986819429868237
100989ggcagctcttcttgcatgtgtgcaaaggcttttcccactt211653072086130720902
100990gcaagcagggcaaaagtgtattacaatgccaagcccactg154003156545231565481
100991tggacacttggccactatcgggcttggaaatcacctctgg212723228002832280069
100992ttggtttggccacactgaactggcacaggcagacaagagt232403318049833180543
100993agctttgttccggcatgagtatcttggcattttgggatcg153993410462534104654
100994ccaggttgtagcagcagtggtgccctcttcattcagtttgc172623501976435019797
100995cttcagccccctctttacccatgggagctaccttgcctga173323567433235674365
100996ggaaccacgttgttgttggagccaggcacatctcattctg193323645642136456458
100997gcaaatgtgccctttgtgaagcacccctcattggctattt153983725789637257925
100998acagtggctagtggctgcaagtgcaaaatgttgccaggaa152573804686238046891
100999ttcatgccatgttttcctgaaagcgtgagagatccccaga173433874116238741195
101000ttgaaccctggcacatcagagagctaaatgtcgggcaggt173063963594039635973
101001gaatctctttggcctgtcaccttcctgaatctggatgttgttc143564010323040103257
101002ccccttctctcttgccattgggcccccaaagatatgttca201964098790040987939
101003gctgcagtaggggaatcaggtagaacccctgcccaaaatg153234196822041968249
101004ccacctttgccgtgacaagttacaaggcccaaggagatgc183964291492042914955
101005agccaatctcctcccctcacgctggatctccaaaggcact173554386370143863734
101006caaaaccctggtgggggtattggactgcccctggatattt212694466834244668383
101007ctactggggtgggtgctgttacaaatccaagaggggctca203864515763045157669
101008tgagggctttttgcaagtgacaacccctggacaacaacaa162104579006545790096
101009cccggatgaatcagtggtttgtgagcggtgctgtcacatt203844625409346254132
101010cattgtggggccaagaaaatcttgcatcaggaaggctgtg183094710033247100367
101011gggccattcagtgacctagcccctgaatcctgcaatcaca212334773099847731039
101012ttcttcggtgttcaaggcaatggacaatacccacgcacctt152294860231448602343
101013tccccctcaaaacttcttggttgaggtcaattccaagccatt184004923495249234987
101014tcagtgtgcctggtctctctctcaaaggcaggcttacctctat202665018664250186681
101015gggggttggggtaactcctggcttcctttctgggatgttt203535112571751125756
101016gtgaagaagccactggcagacctctggaggcaccttcaac213815207655952076600
101017ttcccagtgtttgcaaggtgtcaagatcgagggcatctga153585271210952712138
101018tggtagcaactgagagccaaaccctacaaccattcagccaaa173855349969653499729
101019tcagcccataacacccactttgcaatggcaaactcatggaa172335440694054406973
101020tgctccttcaattccattcatccccctcattacgatggtc203975528190155281940
101021tgccaggatagaagcaattgagggtttgcattggccaagttt163535621491056214941
101022ggtgccatttgtactcatgttctgggcctaaggagtttgtgc153475703824457038273
101023gcattcacagggggacatttctcaagcctgctttgccttt242915790720157907248
101024aaagcctccccgtattctccacccctgccgaccttcttat153985888584158885870
101025ctcctgccaactcaggttcctttgatctgggccaagtcct162775942726559427296
101026caccccaacccttgaggataagcctgcttgatcagcccta152896039633860396367
101027gttcacagcactgggggatagcctgggtccctctttgtta222626132047561320518
101028catccccaccttcacatgtcttgtctacaaccagcccctga161426224690962246940
101029gctggaaatccagagttgactgtcagcctgatacgcaaacca153666323424463234273
101030taagggctgccaggattgttacagcgaaggtgtgctgaaa232906408838964088434
101031agggctcttggtgcctacaatgagccctctgggttgtctt193396508386565083902
101032ggggaagtaagcctgttagcaatgccacaaggagctctctca153936599187565991904
101033gaacggagttgagcggagttctgtgtgtgttgggcaggat202706691460466914643
101034catttgcacagcacctcacatcagcacacaatgcctctca193396784166467841701
101035tgatttggcctgtgatggtcttctgtcacctgctcacttctc184006881095068810985
101036tgctgcaactctgcatctgaccccagcacccttatgctac163636961896869618999
101037ccttttggccctttgaaacacggtgctgtttttgggattc163897060755070607581
11CAP11Eaggtgtcccatggtgtcctcacaggcatgatggcgtactg223497576135775761400
11CAP11Staccccaatgcgctcaattttgggtgcactcctatgcact1825835661353566170
111040tgatgttggatggtgcaagagcagaaatggccaacactca2029043615064361545
111041gcaccagcccctcctacataccagcttttctgcctgcatt1739649929044992937
111042gtgctgctccaaaacgagagggaaggatgcctaagggaca1616959368825936913
111043ctggaagtgcacaggctcaccctgctcacaagcctcaatg1833268122366812271
111044gcagctgccctaaagttgctcctaaaaacaaccccgtcca1623476871647687195
111045tctaagcaacggggaaggaaccccaagctagatgcaaagg1834885450598545094
111046gcagtgtggaggctcctcttagctggcctttgaaggttcc1527693706789370707
111047gcttttcatgtggcaagcaggcaactctgcaaagcaggtg193071002136910021406
111048tggttgaaaaccctcctgctggcttgctcctacccctacc182991081436910814404
111049acagccctcctttctcatggtccaaattgaatgcctgtgc193131168944911689486
111050tcccaattccacaatcctcaggcgagcttagcttggtgtt182811256102012561055
111051ttgttccaacaccactttttgtaacagacccgttcttgtaaagc193981353385813533895
111052ggggttggcctagattctgatggatgaaatgccctgtttg203961434573214345771
111053tagcggaggtgctggatttttcagcctggcaactatgtgg163961522936415229395
111054ggccactatcaccccaggtaccctggggtctttaacatgc213891611772116117762
111055aatgacaccgagcccagaattcatcaccagttcctgacca192521697425416974291
111056ataggctgggctccttctccacggcatatgttcccacaca203211790354717903586
111057ccatgggttttgactgtccattcagtgggaagggggaacta152101849956718499596
111058gtgcgttgcatagggtgagaagctcaacgcaggctctttc243931908721819087265
111059ccaataatttgccccacgtatgggtaagacaaccgaagca174002008092420080957
111060gccatctgcgtcgaatttttcgcaccaccctgaacattta153862089896420898993
111061gtgcttaccagtggggcttcttcagccctggaggttagga171482173623221736265
111062gggccacttagttcccacaagctctggagctgtgctttca151422197827521978304
111063gttgggggcatcattccttatgggttcctgctactgctca233912297343722973482
111064gctgtctcctcgcctgttctgggccacatttggatcttgt173812394119823941231
111065acgtcccagaatcagccactctaggagcatgggggcatag152442449591424495943
111066tggtcatgtctggctgctctgttgcccacttgtcctagcc153782517008225170111
111067caagggggtgtttttgtgtggggtcagcaggaaagaatgg153542579587825795907
111068tttgaagcccatttgtgtgcacgaatggctcagcagagtg153942668318726683216
111069tgtgcttcgcttgctctaggtggcccaactattgcacaaa183562755905327559088
111070ccacactgccaaggtaccaggccggatctaggtcacagca193992807928028079317
111071ccctgacctaaaggcttgaccgcgaacccatctattcaaaatg123142880682428806847
111072caaatggcagccagcacttatcctcatggcagttctcagg183692969568229695717
111073cacattcatgacctgcctcaaagtggcattgtcagccagaa192263066430530664342
111074tgcagtccaagcttcttccagcagccagcactcaatcatc203083157035631570395
111075cccacattgccacccttaactgcagaggaggagactgattga162673255574232555773
111076tcttcgatgttctttgcagcatacattcccagcccttgctaa163723349376433493795
111077gagaaaggcaggggaatgtgtccaggttgagctcatttgc183583417657034176605
111078catacaggttggggctagcagtctgaagcttgtgccccttt153543513963335139662
111079taaatgcaccagtgcccaagcctctttctggcatgccttt163813611336036113391
111080acacatgctggggttttggttctaggcctggaaagatgctg183643682623536826270
111081tatcgcccatgtctcaccagtcttggactccccgaagaaa151393771977137719800
111082ttcctacttgagggcattgtgaggaaacgaaatccaagcaaga154003852837338528402
111083tgagttgagggagggggaatccctgatcgaggatggagaa153183941967439419703
111084ccagtagagttgggcaggatgcttcacagggaagggaccag213604016518340165224
111085atggaggcctctgcacctaagaggacatcactggggaagc162014095726840957299
111086ggcttatgaaaaagtcgcctgagaccatgctcagtggaatgc153714186056841860597
111087caacggtgtgttgaggaggacaaggaggcatcacattcca243664282659442826641
111088gactgatggatgggctgtcaccccaccaaacgagtcagtc153924373417143734200
111089tgcctattaccctgccttccccatggcatttaatgggctaa151294460813844608167
111090gtagaattcgggctgcttggcccagactctgatgcctctc152104535074045350769
111091cagggatggtcgtatgtggagctgattggcatggttgaaa202264612656946126608
111092atttgctttccaacccatgcccccaagctgagatccttca182054697533546975370
111093tggtaagggggtgagaaggatcttgggtttaggcttttgga163894792506847925099
111094tgctagcggggttcaaagattggaaatgcgtatggagctg171264846970448469737
111095ggagctttgtcgtcgtgtgatccaagtagtgcagccatgc162514937251249372543
111096gcgtggggatgcgatataatacccctggtacactgcctca163975028811950288150
111097tggcaggatccctgctctatgctgtcagaggcgctctagg172575102359151023624
111098agcctctagaagcccccttgcccaggaccctccacaaata193605187601351876050
111099tggacacgagcagaaaaggaggccgccatcaacctactat233695272710652727151
111100tggggcttggcttctgttacttggtcaggcagtgagcagt273455325241953252472
111101cccagggcctcataactctgcaaagcctggcacaccatta172305380197353802006
111102cacagatgagagggctggtgttcgctgcgactcaagagag173055445995254459985
111103tgtggtgggacaagacaaggccaccccaggacactgtcta203855505233655052375
111104tccaggtgctacagggaggtctcgcccactctcctcaaac173205589158455891617
111105gaggcccctcttcctgctatcacccagtttgggtttggtt172115672838056728413
111106cgtggtgagggattttcacacacggagagctcgccttact183235766014857660183
111107tgatcctgctcaccttctggggctacctcagctctcggatt183655840371458403749
111108gaaaggctcgcgtaatcaccgataccgggctgcagagaac202985917040959170448
111109aaccacctttgttctgcctcatctggcaattaccaccttaccc163506001103960011070
111110ttccccaggtcaaattcctgatggtagtggccccaaagtg182876080239560802430
111111ctgttgccagttagccatgctgagaccacttggggtgatg172606167259361672626
111112ctgcataggccatggttcagcccttctgctggctcctgta213466215444762154488
111113ccacaggacatcctgagctgtgtgcaatcagcctgagagag212356307105363071094
111114gaggctgattggacctcgttcagcattgtgcatttgctga182846378100063781035
111115tttggacccaacatgctcaggtctgcagctcgttgactgg163056449537264495403
111116agggaggatgcggtttttctggtcctccatggaccagaac173816544877565448808
111117ggctgatgccatgtggatacattgggcctgaatgatggag152886633472566334754
111118gatgatgccaacccctcttcgagcgatcccctggtcatac153326720048967200518
111119tgaataaatgcatgccaaaacattgaaaccttttcagggagaga153916811288668112915
111120ctgggacctttggagacctggcagggcatggcattcttat173746867907868679111
111121agtgcttcccacaggcatttctgtcctgcggattttaggc161966940183369401864
111122tcgcctctcaacacacatcctgccaagtgtcccagagaaa213746974222169742262
111123cccctgctcctcacttatggacggtcggtcgtgttttctt183617054600770546042
111124ggctgggctacatttcctgacaaaggtcaaagggaatcatgt203367144447471444513
111125ccagaaggcttcctctcgaactttcaaggctgctggtgtg172467232020172320234
111126gcattctttgtgtgcctctccgggaggaggattggggataa173837314506573145098
111127tgaaacgtctgtggctgcttctccaagcagggtgtgtgag183857408118274081217
111128cggcgtctacccattgatctgctccggctcctagaaggat183977479031274790347
12CAP12Eggaggctgtggaatcagaggcagggttcccggaatatgaa152917482487474824903
12CAP12Sctttttgcccgtttctgtcacaggtggtggatggaacaga2037036513643651403
121131ttgtgccctcaggaaaaaccggggcattgtggagtagagc1518044822954482324
121132tattgcaccctggtgtctgcttgccctgggtggtaaaatc1233749354454935468
121133cacctggcagatcctgaagagggagcaactggtcaaaagg1737855034565503489
121134gcatggacaatccacaatgggcagctcagaaacgtcctca2129062041116204152
121135gttggacgagaaggggtcagcaccagtgtgcagccatgta1822567118936711928
121136tcctcacccctatgttgatggccacccccactgttctctgt1937176156857615722
121137ggagtcctgagcacctggttcctgcctgagctgactctca1931081466278146664
121138gatgcagagttcccccactcagcgattccagaggaagcag1937290130529013089
121139atgtcagggcatccctcagtagtggccagaggcaagagtc1536996292839629312
121140ggggaaaaaggtgaggaaccgcactgcccctgtttactcc203351051098210511021
121141ttcagtgaggcccaaaaacatgccactgttgctttgggta173611118900111189034
121142caggaattggcttgctttcccccacactcaggcacacatt192761215548612155523
121143gccccttgaggagacatctggctagcctcccaatgtggac223171305032113050364
121144ggagcactcaggaggagcatttatccccgaggtcatttgg201801387289513872934
121145ggacccactccacattgtcaaaaggctccgaggtcctttc161701469327414693305
121146tgtccttgcattggaactgggggattagtgagccgtctgg152951557387715573906
121147ccctctgtgcatgcatttgttgtccatcagggttttgatcc202781633158816331627
121148caggcctgtcatctcagcagcaccttgcatggcaaacatt202351709802817098067
121149gctcctctgacaccccaaagttccaacccctacctgcact203711803728118037320
121150ctcttcccagccaccagagtcatccttctctgtctggctcct203761865521018655249
121151gctgccattattaccaaagaggctgccctgacaaatgaacct163691945193019451961
121152tgcaagctctaagggtgcaggcatggatgcacatgggtaa162692026025820260289
121153caggagacgttggttttcacagggctcagtgcagggtactt172852123266921232702
121154attggcaaaccacgtcactgtgcccctctcttcattttgc162352179627821796309
121155caggatcctcaaccgcatttatccgcagtgtgctgaagtg243652269887622698923
121156gggcaagaagtcctgccatacagcccgtctttgaatcctc213272343945723439498
121157atgcgctcccatccattaaatgactgaggagcaaggtgtca223602436450224364545
121158cctcgcccactaagttcctgtcagcggatgtcgagtctgt153992519128125191310
121159tctggatatggccctgttgaagaactgccaaggctcaagg161232548297925483010
121160ccccgcaaactacacacaaacttctcacgcactgcttgct161592619963226199663
121161ccgtggaaaacatcttggaattgccacaatggggtacatt192592663111426631151
121162ggctcttacccttcccctgtttctacaaccccgacagcaa162352754726027547291
121163tgctagcagagatgaaatgagcaaggccctggtgatgtgttt163962817319328173224
121164ggccttcttggcattgcatatgttccagggctgtggatag213382885114128851182
121165aggcacactggtgacacttcacctgggtttgacactttgga162052967355329673584
121166tggccaccataaaaggatgatgttgccctgtttaggtattgc193983047007130470108
121167aacatcactgctccatgtggtaaaggtactggcccttttctga183343145665631456691
121168aacaataggtggcctgatgaatgggagaatgatccattcagt162903193382131933852
121169gggtcccgacatattcatggtgcaggagggaaagcaattt223733258135232581395
121170agttccatagggcagcaagcaagcaaatgaagccaattcca162133343631433436345
121171tgtgacctgggatgaactgggggttccctcacttattcagga163953440700734407038
121172ttagcagctggggaagaacccagggtcgggaaaacacatt151513529376235293791
121173acggagggagggaaggagtattagggaaccggggacagtt223233617546736175510
121174tttccctcagccttgggttatgtaaacacagagtctcgcaca163423690229836902329
121175tccaaaagcctccctcactctggttcccatctatgcctga202753781819337818232
121176ttggagtggtcccaggagatcaccagggatcccaagatgt172753846381138463844
121177cttctggccgctcaaagagttggggattgttttggaaagg163693928587139285902
121178tgacaagcaacagcacacagaggaaaaggatgcagctgaaca183964005528140055316
121179agatggcatgaatgctggtgaccctcacatgccctttagc172544083081440830847
121180ccctcctagtttgtggttttgcaataagggcaccttggcaat173384177334141773374
121181gggctttcatacccacctgtcatctgccaggcctatatggt201594238393042383969
121182tcaatggggcaaaattttaagggaagggcagacagccagaag173524317179143171824
121183tctttctggtctcattgccaaacagggaaaggtcccaaacaa192714359032343590360
121184ttgagtcgcagagaagcagaagggtcagtcccagaatcgag153524438744544387474
121185tctcacttgcatcaaaaacaggtcagcttctcaagtggcatgat222894516953245169575
121186tggactgctttcccactcaatcagcgctcacttggaaaaa153734605250446052533
121187cgggtaacttttccccaaaactgccagaccatttctccatc171474632363746323670
121188ttgatcacgtttctatgccgtaccctttagacggatattgttgc162754717942347179454
121189cccaagaggcacagggttaggggagctcattcccaatgtc173454806926348069296
121190tgcctgttccaaagattccaatgagggaggggagaatggt222874824816348248206
121191atttgccttgaaagagccagaaaactttccccaggtgagca163804885339648853427
121192tgcaatcttttgacacaccaagccacctttgggaggtatga162694955702449557055
121193caggggtggctgattcatttggcaggcatacacgtccttt121975020326450203287
121194aagaccactcgacccagcatcctgaagcctccattccttg173665114769951147732
121195atcttcggccaaattcctgatttgagcggtttttaggctgt173555187525151875284
121196gcttgttccaagcctctgctcccacaaccaaggcaggtat212355252188852521929
121197ccagtggattgtcccacaaatcccgcaagccctactttta193905323243053232467
121198ggatggggctctatggtttgatcccaaaagcgagaccaga152325370243653702465
121199tgcaagagcagtcaggcaatgcaaaaatctaacacgggaggt173405442896154428994
121200ggaatgggcattagaatcatgttgcgattgtaggggtcatttt163455539757255397603
121201ttggcatgattctccctgaacagaagcaaagtggaaacctga193505590498655905023
121202ccctgtttgtgaccatcctgtcttggccaaaagcatagagg182315655265456552689
121203tcgaggacactggaggttgatgtgcaggtggtgagtctga173135755031957550352
121204ggctgctggaagagtctgctatggcagtgaaccgagacct173035821015458210187
121205ggcagtactgggtcccttgtcacaaaccggaggttatccaa153745912295759122986
121206cacgtacatggcaaggtctcaccctggtggtgggaatctaa163086012269060122721
121207tgcctccatagcatcattgctgttcttgctttgtcccacct213946111042861110469
121208ccccgaaaattggctgtatttcgtgaaaacaaagcattgaga183336210969462109729
121209tcgtttgacccattgtaatgctaacggcaaccagctgaaact152206270643262706461
121210tgcaagaattggtgttaaccatagaaatgctgagtcaagtgcat193546322577263225809
121211ggaccagctcaatcccaaaatacccaaaagccaagcatcc153876416704964167078
121212aggtcgaccagtttcccaaatgaagaatccaggtcgctca153636484007564840104
121213cagctcttcagaatccgttccgagagcaacatcacagcagga152376579360865793637
121214tgcaaacccaaaccaactgtggctttccctctgtggcata203306650488766504926
121215gcagaggccaaagaagtgctaaccctccccaggctaaaga192426737541167375448
121216tggcaaccctaaatatgaaaccttgtttggagtcctggctgtt173166833742668337459
121217tgttccatccatgcttcaggggacattcgagtgcatgagg162266889865768898688
121218tgccacctgttgatcactcctcgaggctccttcactcctc173156976172669761759
121219tgccttttgaggtaagcatggggctttcaatctcaacaagctc153367052705170527080
121220cgtggagcaaaagggctaacgcgccgtctttacctacgtc223417140175571401798
121221aaaaaggggaaaaccacagcgggttaactcatggctccaa151927236270672362735
121222gaagccatgcttgtctgtgcagctcatgcaggacctgtga212447313862873138669
121223ccccaaattggaaaattggaataagggggacagaggaccaa182317394774773947782
13CAP13Ecccagagccctagcctttttggtgctgacatgagccaaag173506589195065891983
13CAP13Sctgtggattgtgcgcatagcttgaagcaactttttccagaga2330233777273377772
131226ccttgaagtgccattcatgttgtgcaccctcgtgttcattct1621542220124222043
131227ggctccctgcaaaacagctaacatgggaccctaccacacc1740050246175024650
131228tagaggaatgcgcgacttgacaccgaagcattttcaacca1728959432465943279
131229ggcagtgaggtccaggaatctggcttgtggttttcagttcc2019566774156677454
131230gctcgattctgggaaaaggacaccagcattccatcagcat1828676758317675866
131231ggtcagttactggggcttgaggtgaattgttctgccaaagc1618586415558641586
131232gagcatatctgcgcacaaccgattcactgacggccctctt1812795355419535576
131233tccgataagcattaccgcattctgcagaaatgccttcctttg203621013553910135578
131234aaatggggatcccagagtgatttgctttggttcctttccaa153931111127011111299
131235aaagttgtccgcttccctcaccctaaccaccctccgtgta173171166999811670031
131236ccaggagcatcaatgttggacaaattgggctaagggatgc232891256112712561172
131237aattcggcttcgggaaatctaacccagagtgggaaggtga153951322760713227636
131238ctcttggactgccactggatgccctgtcacagatttccttg222101406085714060900
131239aatctgaaatgccccctgaagatgtggacagatgtgcttgtg192421495227614952313
131240tgagggagtctgcttttgtcctgggtcatttcaccatggaa153931593884415938873
131241ggggtcttgtgaggaatcaaaatgcctgttgggtgttttgg152511636921916369248
131242tgccatgttccatccctagatgttaagagcctatgcagcaat152291730004517300074
131243gattagggctcacccgattggcgtgttagacagtggcaga163941785987117859902
131244tgtccagattcaaaaagccagatttgttccccggataattgg201781875822218758261
131245tctgcagctcatccaggtgtcagggaaggaccaggtgaag181741964216319642198
131246ccggagcctctcacaagaacttgagccctaatcccaagga193862032640420326441
131247gcctcaaggagaggtacaggaacaatgccctctccccctta193422097208820972125
131248gaaaaggggtcttgctggtgccccgacatgatcaaaacaa242422194302721943074
131249gtgcctcgggaaactgaaaccctccaccctcttgagaacg153662266830222668331
131250caatgcttgggcaacttcaaagcttgccagggaaatgaaa203602350492423504963
131251cctgatgcatcttgggtcaacaagcacttgagggctccat183992428455924284594
131252tcccctgctatgggaaacaccaagggcaaaaccatcacct183782516634325166378
131253ccgccgataccacactttttgacctcggacgagacaaagg213522604434426044385
131254ggcagcatttacaggactgttcgaggactgccagattgacca153982702519627025225
131255gctgatgtctccatccaccatgtctgccctttcccaaagt193762801938828019425
131256tcttgctgtccaaagccatcgcatgactgccaaagtgagg183402885928128859316
131257tgcaaaatgcctcatcgactatggggttcccaaaccttct173572978820629788239
131258tgggaggagaaaccagcctacctatggccctgagagcaag222083077134230771385
131259atggcaacagtcttccaccaacccttgtgtctctatcacacg153733144923931449268
131260gaggacacttttcccccacaactaggacagggccaagacg173523244175732441790
131261cccaacaccttcccctacaagacccagctgagcttcctgt183473319591033195945
131262cgtactgcccagtttttccaaccactgatgccctgaaggt173363418238434182417
131263tatcttccctggctgccattagcccctcatatcccaacct172913490958834909621
131264gagaaggtggggcatctcacgcatcaagctctgtgctcgt193863576841735768454
131265ttgccccaagtgggtaatctgctatgggtgctgagggaag183773657699136577026
131266gggtttggttttccccatttgtacacatgcccgtgtgctt171713754366637543699
131267ggatgtcccaaggtctttgctttggactggcttgtgttgtc193143850910438509141
131268ggctgctcctttaggggtcttctgggggagtcctggtaga161623941464339414674
131269gcaggtccatgttttcaccagcagcagcctgagctgatta142654020336440203391
131270aagtgcaggaggaggagctggcagatagccaggtgtgcag203704100656241006601
131271gcgccagtcatacacgtctcgattgctccgctctgctacc133234166679941666824
131272acgtgacgtgacggtttcacggccaagttcgacacaggta193974248494542484982
131273tggctgctctgaaacaatgaacaatatgaccttgccgcaga172584332755543327588
131274atccaactgcttcagccacatctcacagcctcctgtgcat182494397729943977334
131275ccctgaggatcttcaagtggatggtacactgcaggaaacccta163454484782344847854
131276acgtggtactggggctaggacaggctcttgcatctgttgg162664559329445593325
131277agtttgtttggacccccagacagttggggtgtgcatgaat191304574440545744442
131278tgccagcgtgctcagactatgccgatattgccatccattt162994672144046721471
131279aatggggatgaaaatgcctctcgttggcatctacccctgat173564751642847516461
131280ttcccttcaattcccaggtgcaggtaggccccagacaaaa163664845723248457263
131281ggcccatggtcaagcattattgccatatggaaaggggaaa163584944193749441968
131282ccttgggtccacttctttgctcaggatttgaacccctggt202445022359850223637
131283tggtgcctggcttcctagatcccagccaacacatccacta152935063171250631741
131284cagcctagctgcccctaagagaaattccatcccctgatgc203815156482251564861
131285gcaacccacagatgatgagctgccacccaacagtttgttc152945236954252369571
131286agcaagggtttcctctgctgtcccagaatcagggcttgtt202265332833453328373
131287gggcactctcaacctgatcctggtgaggtgggaggaactt233735415853654158581
131288tcgtggcttcagtctttccacggcctttccaacacctaaa193575509519355095230
131289tgaaacggaatggtgattgagaaagaccaggaaaatggcaac173395543491355434946
131290cacccatggtgtagcttccaccatcctggaaatggtcaca162365630939356309424
131291tcaaggagcaactcccaacatggccttccaaaccctaaga153825728898157289010
131292tcaatcggttgagcgtcctatgcagtttttccctcatcca172895815317758153210
131293gcccttgctgtattcccaatattctgcacagggtggaagg193215907873259078769
131294ggcccttcctagtcttgttgccattcagacgccagaaagca172816006907460069107
131295gccatgtgactgacctccaatgagcgggaggcatttttat163806078753160787562
131296tattggcctgcatgatttgcattgcgaccatgaaacacca193826156216761562204
131297gcagccggttgataaatgctggcatccggctcctaacat203926236640162366440
131298atgaggcccttgaggcataatgtccactggccaccagtaa182666286089162860926
131299tgattcccctctcctgcctattgaactcgcttggcacaat193986379048063790517
131300tcccacactcaagtccatgctgaccagacaacctcaactgg183726470497764705012
131301tgacttgccatccaaaaccaggaccctagtggggatgtaga163476554368465543715
14CAP14Egcctctgggccactatcatccctaggagcagagccctgaa223686349763163497674
14CAP14Stccagatgactgctgggagatgcatctctgcatatgtgttgc1826738164713816506
141304caacctgtggaccctcagaagctgtttgcacaaaccctct2039446381024638141
141305gcatcctacgggaattggagctggatgtgggcatctcctt1639855315725531603
141306cccacagcttttgaaacaaggttctgccccatttgtcagtg2337963666066366651
141307cctggggactactgcctgacacctgcagccctatcccttt1521868712496871278
141308cacggtggccagaagatgtaggggttctgtaccgacgaag1529276529577652986
141309gggcgcaaaggtagtgagtcgccagcattcacacacacaa2035985941678594206
141310tgcccatccaaacaaagaaataaagccgggcaaaaatagc1725293528279352860
141311tgcactgccctgagacagatcaaagtcaacgtgccctgaa192321034472610344763
141312gaccaaaattcttccccgagtgtggttggtcagcccttctc183891134407311344108
141313tgcctgcagaaagccatttatgcccatgtctcctcctttt163241179743311797464
141314tttggaacccacgatgtcactctctgctcagttgccagga192891278494112784978
141315ttgcttccttcacaccttgctgtggcaagggcagtttcta183011375246113752496
141316catcaaattctgggcaccaaatgggaatttctggcaccac182931428937614289411
141317ttgagattcccacttgggtttaaaaatgctggtgtgtgtgtgtc173221521881415218847
141318tccttcccatgaaacagaacccccaaataagttggccctga173731613597916136012
141319gggtaatttcgaatcatttccattatgtgggggaaggaatgg211091712931217129353
141320ccagctgtgggagggtacattgttgagagccttaagcaacca183721781819117818226
141321gcaactgggttgtcattgcttgtgggtgagaggagaatcaa172981823521818235251
141322tcccctcagctgtgaccataccaatcaatctgccaccaaa191241922779419227831
141323aggcgtccctgctaaaccttgttgagaaggggcatgcttt203711998898619989025
141324ccaggaacgcttgaatcaatttcctcactcccccaaatagca173962082432920824362
141325tccatagggaaggacaaatcaactcattgggggccattaaaa163122163411421634145
141326tcagcttctcaagggctgaaggtttttgccttgggctacca172382240998822410021
141327gggctttgcaaattgcttgtggagattccaggcattgagg153842327898423279013
141328ctgaggctggctttgttccttcttgatgcagcaacctgtg213932417761324177654
141329ttgccctctacctgtcagaatgtgtcccagtgtgtgatgtgg163652454057024540601
141330gaatttgccaacaggggaaaccagccttgaagttttgacg202922536194925361988
141331ggaatgggatgttggtggagccacccggaactctttcctt153972586935725869386
141332caccaatccactgggctttttttccagagtcatttggtcaac202372686285026862889
141333ccaaacaaatatcctccccatcttggtgggaggagacaaagc173662767953427679567
141334ctaattccccaacccggaattgagaatgagactgcttggaaa151802812614328126172
141335ttcctttctgcttgtggaatcgacatccattgtgcctttgg192832860825328608290
141336gccaagaactttggaaatgtgggtctgtcgaggcaaaatga182612938176129381796
141337aggtccaggcctatcccattgatgggcaaactcctctgct213883016425730164298
141338tgtagcccctgaccctgtctggggcaaggagctactctca162193104006531040096
141339ggctctttgcccatgagaactatgttcccctcccatgtcc222303151264331512686
141340caagaagggtgcaggctttgcattgactatggtgtgcatgg163053242732532427356
141341tcaccacgttaccatgaaccagagggccccatgacagataa272923328058133280634
141342tgtgcactccatggtttggtagacccatgctctccttgtga153873417958334179612
141343cacggagggccttttgtttatggggaagactgctgtattga173043502436335024396
141344tccccttttctcctaaccactgtggctacgtgtccataaattgg172843573456835734601
141345ttgtgtgtgtcctgctgtggggggcaaatagcaggtctga182943638333836383373
141346ataattcgccgttgcattccgctcgtcctgaggatttcaga183933718716137187196
141347cgtgaagtgatggcacttggaagcatagccaccctgttga202563804061638040655
141348cggctggtgtgagcatagagtcctgccagagtggttacga153543884286838842897
141349cagtgctgattccctgacctcgggaaagggagaattttgtgg142083912185139121878
141350cagggggactggagatcactggtcttgggatcaccaccat153934005360240053631
141351cgtggggatctccatttgatgtctccctgggtggtctctg161714093670940936740
141352tcacagcccagtttggaaaagggagacaagctggttggag202164190097141901010
141353tccagaaaaactgcccaaccctgcttgctggtgaaggatg163434264582342645854
141354tttgcaaaccttcgtgaggatgctcatgccagttccttgt153994313466343134692
141355gcctggggcgagtttaagttccagcaacagctggctacac153174413277144132800
141356cgggaaattgaagcaagaggtgggttgaataccgacatgc212834505821145058252
141357cagtcaatgcccctttaggcgctgcttggcactgaaacag192844604220246042239
141358tccagtgctgcacaaactcatgacctggaagcccagtttt203884679032346790362
141359tttcccccacagggttagtgccatttcttggttgccctct193754762009247620129
141360ccagacaccgggaaaatgataaacctgggagccagtcaaa192924850296348503000
141361gaaactgcaccgagttccaacccacctggatgtcaaacaa173764891409348914126
141362aggaagccatcacgcagaattgcagtctgccccagaagta143954946210449462131
141363gcatgcacatacaagtgcctaagggaggtggcttctcaacaa142444991997149919998
141364cagagtgcttgtgggtttggttgcaattattcccgctgtg152685056332450563353
141365aagccttctcctgcaagcaccgaattctcacgggacaaga163575113442451134455
141366caggactttggttgcaatttcttgctttttggggatggttaaa173725151413451514167
141367accccaggtgagattttccagaatcaaccttgaagccatgc152995250364352503672
141368tgccagttccatcatccaaggggggacatcctgtgaaaaa183825342567653425711
141369acgctccagttcctcaccattttggagtcccctgaaagga153275442281254422841
141370ctttcgtgtttgtgctgcatccaaatacaaagcccccttta213985533998955340030
141371tggcccttggtattttgagctcatgctgctctatttccttgg202045555240355552442
141372acggggtgttggttctggtacgaacacaacgagggtcaag203845653465856534697
141373ggtccttctgtccgcaggtacctggtcagccagagatgtg213735703026557030306
141374caccacaggggaattcacaaaactcctgggccactggtaa153295772770657727735
141375tattgacgggcccagatttctgtgccctcaacaacattcc191355840218758402224
141376catccaaacccacccaatctccctgcctaagctgttgtttg183825926269859262733
141377ttgaaaaacccatcctgattgactggtgggaaacgctgataa172135996966559969698
141378ttgtgggcagttttggactttaaatggcatcctgggataaaaa153356092644660926475
141379cagcgtccttacccctgaacgctctgctaccaggcaggtt173456168010861680141
141380tgatatttcccagccatcaccaaacccaaaacaactgtgtgaa193706229853562298572
141381tcatcggcccaaactcttctgcttgtactcctccgggaca183656323621063236245
15CAP15Egcccattgtctgccatttctttaggggaaggggtctcctc223966690686566906908
15CAP15Scagtccgcagtcctgacaaggtgagggtgagagggaatgc2033938602063860245
151384gggtcactcgagaggtcaggtcctccctagcccagtgttc1539047584464758475
151385taaactctgcagggcagcaatcctttccgtgtgatgcttg1729956598485659881
151386caaatgctacgtgccgacatttgtccaggaagcgttgatg2118164352546435295
151387agtgtcggcaactgctgtgttccaagccttgtcccagttt1625371920677192098
151388ttccccatcctggtaagtgccggaatccagaccaaacaca2019381814888181527
151389gttacagacgccggaggaagctggacaccaacacgaggag1825888928068892841
151390tcactgggaacttctcctccatcttcccagacatccatcca1935192485759248612
151391gccgaagacaggtcacacagcggcacctccagactttttc183971016910310169138
151392cggtgacagccacgtttttaaaagatgggaaaggccgatt152311058808710588116
151393gcatcctgccttgatccctatccaggacaccagctatcca132391065230410652329
151394gtctttggctcctggattgccacagcacatggtgggtctt93481082570110825718
151395tcaagagctcggttttgcagtggaacacatctcccacagg112071176351111763532
151396ccaaggtgcccatggagtattgaaggtcttcggaacatgc232181250302712503072
151397tgggcttctgctctaatggagcaaattctgtcccaactcaca143051275227712752304
151398aactgaatgacatttgggcaagtgccaacccctcttttatgc132611346218913462214
151399gcgacggtgacattgtgattcgttcctttccgcttttgac173701394540713945440
151400agattgggggcctaaagcattgtaagggaggcagccagtt152611488727614887305
151401aattggactcgggtttgctgatccctcaccctaacgcaga153331579921115799240
151402cattcaaaatgtggtccaggaacctctctgggacagggatctt173921626301116263044
151403tgcgggtcctctctattcgtatagtggttgggccctctcc163131708967117089702
151404accccttcacaaaggggattttcacagttatggggcaaagg213821808026418080305
151405tggcttcctcagtttcagcattcagacaatgcagggatcg163541899363218993663
151406taaggtgggaggctcaaggatgctgcttccaggcctttat153591952021519520244
151407tgccacaggaacacaggtctttttggtggccaaggagtct163402038990920389940
151408ggcactgttctcccaacacattcatcacctcgaccaccac153552119132721191356
151409gtgctgtctatcggccttcccagtgtggcgaggattgaaa153662210423922104268
151410ccgactatgggaggtgaaggactgagaggatggcggaatg171312293393322933966
151411catcacgtgggtgacgatctgtccagttccatcaccagca233262390904123909086
151412cctccggtttgcctccttatggggcttttgcaatcaaaga153772482156324821592
151413ctgcaccgggtggaaattatccctccactccccctctatc152992573924225739271
151414tccctttaccccacctgagacgacacctggacaaagaagc163032659714526597176
151415aacttgactggcttggtgaacatgtggctgaggagccaagta183502732313027323165
151416gttttgcttgtacccgtgctggagtgagcgcattcaactg172642795890927958942
151417tgtgacaatgcacaggtttgtttttgccttcccttcaatactct173122885396728854000
151418tattgttctggctcgcttcgccagatttgattgaatgcttgc161612984852829848559
151419cccacctgtctatggctcaaccccagatatttccatgctga184003054820530548240
151420gccagaagtgtgggatccttggtcagggagtctctgcaggt173553141105431411087
151421gcatttgcatcctgtgcattcctggaccatgtctgcatgt173283219492132194954
151422ttggcagaggcgaacctatttgccatgcctatcagaccag182803316305433163089
151423gggccagcaggtgttaagtctgcaccagtctccctaagca173333400750834007541
151424aatccaattcggatggctgtctatcggcccttttgaggtg173923477964934779682
151425tgttggagatttcagttgttcctagtgcctccctctcggtgt212393572797735728018
151426accaaccaagaactgcacgagtgaattcgtgatgccagga162923629759436297625
151427tcggaaacggcaggtcttacattcagcctcccgactgtgt163773725161137251642
151428tgcagaatccagaccagcatccatgacactgcccacttgt153063775850837758537
151429gccaacataaatgatgctgctgtgcacaaggtgcattcttcc163873826227438262305
151430gatgggtgctgggtaccactcatctcaacaatggccagga173593920495639204989
151431tgagaaagaagaaccacgcaaagatatgggtccacgctggtt153214003460440034633
151432tatcggctccaacacaccacctggatcccctgaaagttgg231754076298540763030
151433ggggacatcgtgttgaacctatctgcccccttgaggtttt161214116065641160687
151434tccacaatcaccaatcccttcgtgattaggcggctttttgg233604207027142070316
151435tcgtcccatgacaaaactggcccatggggaactaaacagc163844299965242999683
151436tgtctgccacaaagccaactgccccaacctcaaatacacc192104397243543972472
151437gggttccatgtaaacaaagcatgatgtgcccttttcaatgc193384491739944917436
151438agcgatcctcatgacccacttggcaggtactcccagaaca192974588921045889247
151439ttgagcaaaggaacctgtgtgtttgggaactgcttggaagg193494674344446743481
151440attgggcctgtcactgctttgggggtagagcaaacactgc203384770201647702055
151441caccttttgacaggcatggaaacagaggtgccttcgtgct173294827336848273401
151442ctgcttggaatggggaagtctcccaactcccaacacaaca203674919817949198218
151443ggattgcctaaggacaaagacccctcagagctcaccatcccta192555005747750057514
151444gtcccatgcagcaattttcatgtccatcttcctgctttctga193045086821750868254
151445gggcccacccatagaagaattgcctgggaagtttgttcct193825144084551440882
151446gcaggtttttgaaatgtcttcctgctgggtgtactcacttgg142525146361051463637
151447tgccagagtctcccacctttcccccacacacattaggaca123175238713152387154
151448aatcacgacctgctgcgttagctaaggcccgaagtgctaa163225318643253186463
151449cttatgtcagccccctccacttggttaggccaaatgctca222755416498254165025
151450tctgtgtgtgccgaaatgaactgcccaactcaccaatcac152425514093955140968
151451tcagattgcctggggtttctcacacagcccttcgccttat173935581304755813080
151452tgccaagatcttaagggttgcgctgtggttgcccagaactt163545635113356351164
151453gccaggaggatgatctggacttttctggtttgagcacccata182995727328757273322
151454agccaagcaggctgtagacgccattgaacagcaaaggaggt153605785547257855501
151455cttccccaccacaagcatcttgtgagtctggggagagcaa162675863668958636720
151456cggcaaccctcagttttgtttcctcgatggcagacacact173625956625459566287
151457cccaacaacccagtttgtgacatccatttgcctttcggata192105977788559777922
151458tggcatttcaccttcttctcaaacttggccatgaaaacacga151656063323260633261
151459ccaccgtctcctcactggtatcccaagtgtcgatccactg173036147434861474381
151460caagtcccatttgatttcatgcttacatgagggcagcagtcg152226223573162235760
151461ggacgggacagatgggaataggttgcagctggtgtgtgtt181916308647463086509
151462gcctgctagagccatgttccaacacatgcgggagagtcag173616375711063757143
151463gtgcgttgggagaaatggtttctgagcaaccctcacatgg213986457949064579531
151464tcgtgaacggtgtttgctctttgctgccagttctccacat163986550065365500684
151465ccattcgaaaccacatggaacagatttgtgccgcatccta183256646391066463945
16CAP16Eaccccagctaacaccgtcatttcatgtcagcagcatgtgg152775958049259580521
16CAP16Saaagtgccctccgtcttcaattgccgattggtttattaggg2233755551535555196
161468caaccaagggcacacacctagcaaaaccagaaccccacat1524156700255670054
161469gctgctcaagcaacgagctatgcattcgactgcttcccta2230166436566643699
161470gcccctctattcaatgggctacattcacagttggaggcatca1431068501256850152
161471tgcattctgttaagtcctttggggcctgctctagccacactt1630078394627839493
161472caagggaaaaccaggttggagaaccgattccactgggaaa1838787423258742360
161473tgagcatgatattgggatgaaatcgtgggttcgtggtagaaa2035497123019712340
161474tgtggatgaaacggaataactgtttatggtccctgacactgcat171851034213010342163
161475ccaaggcttccagttccttgtgagcctttgcaattttacga182481126687111266906
161476cccatctaccctccagcatcaaggaacaccagaccccaaa153961178542911785458
161477cactggcctttgtgatgctctgcagagaaatagccctgctc153721276605212766081
161478tcctacaggccgaaccagattttctgcctccgttctgtga203961369270913692748
161479tggcaacttgaagctggaaatttgtctgacagcccccttt182251410136014101395
161480gatgactggcaggggacttcaggcgtggtaggagggagtt153751493817014938199
161481gatcatgtgacccccaccttaacaatgggcgtgttgacag151691520052915200558
161482ggtagggtccaggcgtatgatggcagaagcggtaaacaaa183851609119416091229
161483aggccagctggtgaatgagttatcgtggctccccaactct171551686427516864308
161484tcttgctggtggctttctcatctgctcccagcaaaacaaa153621724277317242802
161485gatcccactgccacttttccggtttgcatgagcacaccat183411816619218166227
161486tcagcttcctcccattggtttgtcccaagaaccagcagaa153511891914318919172
161487ttgtgcccacctaccaacaccaccaacaccagacacagca183071975842319758458
161488tacacgctccatccttgtgggccacctcccgtatgtcttc152272049828320498312
161489caaaatgccctccaaggtgtactgtgacgctgcaagccta203592129749521297534
161490tggtaaccggcctctccatacgcggagtctcagtgaagg173652187216121872194
161491tgtgtgtggcaggttctgtgggatccatgtcctgggttgt151402262310422623133
161492ggcccataccagtgcattttccagtgttggccacttttca153472350767523507704
161493aagcaagctgtccagcaacactgtcccttcactgcccttt193122422800424228041
161494ggcaacaagaacaggggaacggggcttaatgggtgttttg183162486308624863121
161495gtggcttgcttctccagcttcagataaggtcagggccaca182492575891525758950
161496taagctcagcattgccctcaagaatgcaggaagggagcac163592664053226640563
161497tgctcaaagcggtcaaaagatcccagattctccaagggtaaa172902748830927488342
161498gctcactcttcatggcatcgtgggggctcttaggtgattg153042830493628304965
161499gagggtgtctcatgggggtatcatcgaaggcaaagagcaa203522926912429269163
161500cccagatgccaaaaatgctttgctctgaaggggctcattt153193004217430042203
161501ccatcatttgtgtgctccttggtgcaaaacagtgcggagag153053081664230816671
161502gcgcagtggtaatttctccatgagcaccaggttccagaga203213145849631458535
161503caaaaattgctcctgaatccattccccagttctcccttgttg162603236002832360059
161504agggtgcggggaggttatagaaagatgaaagcccacacacc153953333055933330588
161505aggcatcccaacaattccacttgttgccctagcaatgaaca172293430297334303006
161506aaaggtccaggagcaaccaaagcattatggggcaaagcat202983495653034956569
161507ttggcagattatggtcccaacgctatggtccattgtggatgg151963575625835756287
161508tgggcccaaaaataatttgcggcaaggccatccatattgt163293669345236693483
161509taggcctgggacatgaaacacagcttggctatggggagag161713742429737424328
161510gcttaacaaacggcctgcatgatgtctggggtccgcttta173603792416937924202
161511tctgagccactgggatttgattccgtaggcgtatctgcaa172833860413438604167
161512gtatccccttgccggttgtagagaaatccacggctcaggt192483927710839277145
161513gaaggccttggtccagaatgatcggaggcacaaggaaaaa183054022300440223039
161514cattgcctaagaaaccctccatcaattgggggattaatgaaca193934099666340996700
161515ttcccaggtgtcaaggttcagtttttccccctcactgtgc153034175035941750388
161516gccagcactatcctcccaaatttgggggagtcatctccag163974256070342560734
161517gggatgtcacagagcctgaaggtgaggcaaaaagaattaacg183204349523043495265
161518agatcccatgccagacctgtatttgggattcggtcaggaa153794440442044404449
161519cccatggtctccttgacacaacctcctccctcctgcattt213194521497545215016
161520cctcatgacaaggcaaccagagatgcaaagcctgggagaa163594568978745689818
161521agggctgtgaagggttgtgtcaacgacgtcggtctcctaa153404648068246480711
161522tgggattcagggcttcttgtaccgcagctcacactgacat193894739784247397879
161523agcccattcagcacagatgaggggatttcaactgcagagc223534808298448083027
161524gggctggtcacttttgaaggcctgctcgccactaaaatcc161744901050149010532
161525tcttgcatctcttcccagcagtggcaccaaggggctaata173204999609849996131
161526tccccatttgcatgttttccgcaaaccattgccagtcaaa202695088631350886352
161527caggggaattctcatgatggtcctcctgggaatcaagtttct183295182577551825810
161528tggggcctggaataagtatttgtgaatggaagaatttcatctgc173405269653752696570
161529ccagacagttccaccagacgtcttgacatcagcgaccttca172595349935353499386
161530aaacaccagcaacaccatgcggccaatgtcccttgtgtct171875438256954382602
161531ccagaatgccacattgttttctgcattcttgttgctcaaaacc153385534919555349224
161532ctggtgcgtctccagaatgacccgtcagccatgatcctat203515630172056301759
161533tctgggattcaagtgggatgagactcccctaccaccacca161585724063257240663
161534gatggtgggatgtgggaactgcactagacacggagcgatg163755805371258053743
161535tcacagtctgctcccaggaaagccacaggttccactgctt163505866254158662572
17CAP17Egaggtgggactggtgaggaccttctgcctctggacccatc162586611226566112296
17CAP17Sagggctagagtgccatgctcgctgatgagccagcaaagtg2238731594053159448
171538acgggatgtgttgtgctttgaacaaggccacttggttgct1624334524323452463
171539ccatcagctccttcccaaactcaattgcagaggggctttt1831144385914438626
171540cctggtacgagcctctgcttaagcgccgttgaaagacatt1529953450495345078
171541ggcccattcctctctcacacaagaaccacggcaagctgtt1634162680496268080
171542catggtagatgcgccacaatccaatgaatgagcaactggcta1535971185577118586
171543aaatcaaagctggaggggttttcgaacccaggggatcaata1626781042258104256
171544gaacgcgaggatccttcaacccagggaagtgggtgtcatt1738890717839071816
171545gcccctcaagtgattgatcccaaacaagcacagccctcag1738797265279726560
171546ccttcccagatgctggagtctaacccagccacaaccacag153581018067310180702
171547ggggaacaaaggctggtttcttgctagaagcgttcggtga232331114563211145677
171548gcaagaaggccttacccacacattccaacatgggggctat173751205361212053645
171549tgggctggaggtaacagtccaactcagccacgcatcaaaa152671281848912818518
171550acccagaggacctaggcacaggcaacatcgtctccacaaa193971371289013712927
171551gattgggacaggggagagtgaacatggggcacaacacaag183701460424314604278
171552cgtggtcaattatggcaacctgctgctgccaatacaacg183721546805615468091
171553ctctccatccacatcggacagaactctgcccaggacaagg223301624391916243962
171554gttgcaagccatcaatttgggccaaggaccaagtcacaca212711714991617149957
171555caatgagcccatcgtcacagacacccacattccccagaac172141814411818144151
171556tgaatctgccccaaagtaggattttcccatgcccttttcac163951903650919036540
171557ttccattggctcattggctacagagttcccatggctcaca173732002013420020167
171558tggtggtccttgacatctgggattgcgagattggggtctc182832070910420709139
171559tgtttggccctcctaaaccagcgaagaacttcagggctgt152152169471721694746
171560ccctgtggcctgacctagagaatgtgtgacgcatgtgcag153602254977022549799
171561agcccaaggtcccctgtattgaggatcccctcccagtgat192952354609223546129
171562ggctggtcctaacccctttcaattcctcagccccagacaa192492430971024309747
171563gccctttcccaagagacagagggggcactaaagaggtgtg201912519218825192227
171564tacccccaggtttgaacaggggaaaccagggatgtgttgaa153392615831426158343
171565caggcagagaaccaccacagtcttaaaagcggtggcccta182002706260727062642
171566tgctctaaagcccaaatgtcctcacctatccctccactctgg203382785821227858251
171567aggggctgtgatgatttgctagtgaaagcccctgaaacca142982882630428826331
171568gccagctcaggggttatgaggtgccgttggaaaccaaaat193422943678229436819
171569tgacaatcttcccagcaggaccagcttaggaacccttcca153933002019330020222
171570cctggttcagtgcctccagtaggagaccctgtttgcctga223923101505231015095
171571ggaggaggaatggctctgtgaaactgatggtggcgagctt152553199626031996289
171572gggaaacctccctcttccagcttgcctaggccatttggag153103290605832906087
171573tctctcggggacaatgttgacaagtcattggggacaagca201643378016933780208
171574ctcatggtctaccgggaagcgcgtcttgcccttgttcttc183133458723534587270
171575tgtgttgtgccctaatttgctgatctgtagctgccaaccact163463551323635513267
171576tgaggtcacagagcctggaagagcaagcccatctggaagt173903650541336505446
171577gatgatggggagctcagaccggttccatgcagggtcattt191273744802737448064
171578ccgttttgcccttagtttcgtccaaaatggacaggagcag183803832933938329374
171579gcctgcggaatgtccataattgacctgggccttttcactt173623931414539314178
171580tcttcccgtgagtgtgggtaagccctaaggagccaggaaa203324025442040254459
171581aactttcccctccctctccatttcagtggggcacacaaag182694118038941180424
171582cccatggataccccttcagatatggtaaggggctgggatg153354204828042048309
171583cgaacaccactcgattcatcaacctttcaccgcatctggtt163514271343642713467
171584agcacctcgtggccttaaaatgttctccttttgccccaat163994337161043371641
171585tgttcacatcctacccaaatgttatgggctttgccttccact153984394839943948428
171586gccatgccaacaaaaacagacccagctcaggtcctacaca172234470034844700381
171587ggattcaggcctttttgctgtgttgaagggaagccaaggt203844545217845452217
171588tgcatgcagtcctcctaatgaagcgacaactcttgggcact202244633712946337168
171589tttccccaacgtttcctttggcatccatagatcgccctgt173024715713947157172
171590ggtggggcttgagctgtttatggaaaacacactgggatgc153304777698647777015
171591cagatggcaataagcactggaccagtacagattggctccagaa153634875266048752689
171592cagcacctgtagaggtcatcattcaaccaaatgttcagaaacca173984947425849474291
171593ccaaccttgaagctgggaacgaggctccaagggtgtcaac153375029292050292949
171594ccacctgccctctaatacgcctgtcacccaacagctctgc161705073677050736801
171595gaaatgcccaaacttcattgatataccagctgggcaatttgg173945173220451732237
171596gcctgggtgaagtcccaataatgcttggtgcttccatcct183725272074452720779
171597atgccctgttaggggttcctgctcctcccaggtgaagcta183855364564753645682
171598gtcctgtcggatggacacaatattcggccagctgggttat152945442436454424393
171599aaggcgtggaaaccttaaagcgctcaggtggccttcttcat153965487844754878476
171600ttgtaatggggtgaggcagttgccaccttgcactcaatct162985569339155693422
171601ttagcattgttccccgatcctggttaagctggctgggagt193935663050256630539
171602ggctcggaagtgacttgcttttctgactcaaggcatggtga152245732000757320036
171603cggctgaattttggttgtcatttgcctaatccctgggcta173605793727357937306
171604cttgcccagatttccgtagccccaccattgcttgtttgac202325886525758865296
171605atgccagtgcctttgaggtttcccttcccctgaagtttga181725969923959699274
171606agggcagtggaatctgaagcccctgcttgataactccgaaa182946055522360555258
171607gacccctatgtccgtggtgtccactccatgcagactgagc202166144031961440358
171608tcagaccctacaaataccgacacaccccagctgtgacaaaag152946235736062357389
171609ggatctgtgctctgggttcccaactctccatcctggcaca162626262878462628815
171610tccttgggcagttgttctcagtccttgcactgaccaaacg223836344138063441423
171611agcacaccagaacgtggctaccccctaaagaaagcgcaat183806440347764403512
171612acgcagacatgggtcttttgccaaaccactccacaggtca182806516274765162782
18CAP18Ecccgtgagatgtgtgggtagtctgctcaggctgtctctgg153706559889865598927
18CAP18Stcagtgcagtgcttggaaggcggtcctggattcccactta1536137807773780806
181615actgaggctcctggtggaagcagggcttgcctacgttttc2426645550664555113
181616gccacatggggttagggatatggcccaattaactcccttg1816755200765520111
181617aaaatgggttttggtctgcatcgatgaccctctcccctgta1538063758676375896
181618gcatgcaagagtccagtgaagcaacccaacagacatggaa1926871674107167447
181619catgtgcatccacactccctaggtcagcagcagaacattgc1339379969507996975
181620agggcccacagctaagcataacctgtctccaatccccact1534085899948590023
181621cagcatccttgatgggatgtgatgagcacatgggggttta1626594352799435310
181622tgtccgcagtacaggagtggccgtttcccaagggtagtca193511007611510076152
181623atggtttgtggctgtgttggtgtgcattgagtacagccctta183681096418010964215
181624gtcctcttcgccgtgactctcccaaggggtcttcactgac183731193896911939004
181625gttgcactgcccataagcaaccctctcccatccccaacta163621273139912731430
181626gaggaggatgttggcagcttgcctccattggactcagctc182451365093513650970
181627gtgcaattggccatcaaagacaccactggcctgacaaaaa163841403746214037493
181628tcctcttggtgggaggaagaccacactggacagcaaagga142271406970914069736
181629tttggatccccatcttgtcctgaatcctcattggcagtgg113221480519314805214
181630aacaatggcggggaagtatggccacacaggtggtgtgact193751545844215458479
181631ctgtgtgtgaggctccaagggccacagagaggttccatcc182881644826416448299
181632tgcccctatgccagctacttattgtggccaacatcacagc212931732406917324110
181633cagatgctcctggttcagcagcccacagcccacatttatt163741825059118250622
181634ccctagtgcaaccacccaaatcggcatctgctatgtcacc163901905227519052306
181635aactcattgccagcatgcacaaaacctggctctgctcctg162261993456019934591
181636gattcaggcttccccctgattgctgatcgccatcaagatt152662090942720909456
181637ggggtcagcatcaaaagcatcccctaacctcccccttttt212842189926621899307
181638ataggggcatgagggaggatgatcagaagccgatggaagg153412286804522868074
181639ggcagaagcaagcccattacggtcacaaggacagcatgga153672311316223113191
181640aggggcttctggaaggctactgcatcccatgacgtagagg162662410531524105346
181641ggcagggcgaattttattgattgagcccccttaagccata153572503844825038477
181642gcagtggagctcaacaggtgcctccggaaaacgttgtgat183702583698525837020
181643ctgggtctggcaagaggttcggggcccaggtctctctatt183782666595426665989
181644tacggccttctcagggctactctgatctggtgctggtggt203942765933127659370
181645gcagacgcacagactccaacgtccttgctcccctgtatgc173782854908428549117
181646tgagaggggtggtacctgctctgacgccgctaactctgtg163092952611129526142
181647caccccagcactctggtacacgtgcaccaccatctgattt153233020488030204909
181648cagtgctcagatgccgtttcccccaagatccggaactaca153323056233430562363
181649gggagaggaatctgggaacagggggagtttttgcattcta182213128698531287020
181650tctgtcccagagaaaggagcattcacggcatgagtttccac183223216413032164165
181651ggaaacccatcagaggcactaaccattttcagggcatcaa162483265964132659672
181652accagtctggggatgaaggatgtcagaaagcaagcccaaa143693341165133411678
181653acccgaagaaaacctgctcaggtcccattctttccaccaa163713420457834204609
181654ccccggattcctgttcattaccaagtccttcccaggagac163123490088134900912
181655cttgggaaactccacccagaccccctcaagtctccaaaaa183573576568335765718
181656ctcctctgtggctgttgcaggtctcaccttgctggggaac192833622350336223540
181657agaaggttgatgggccttgaccttggcctcaccaaaacat161313708834937088380
181658gtgggaagctgccacctaaccaaaagcccccttcttttcc153663798779537987824
181659cgctcctgcacgtttgttagccacaaaagtgcttcccaca183463888470238884737
181660ctgagtggcttggagcattgtctgcagtgggggaggatag192583985730039857337
181661gcatcttacactgggcttttccttgttaggtgggtggtgctg173554064708140647114
181662ctaatctggccaggcaaagcggactttctcctggtttgcag172674151736841517401
181663caaggtccctgctgaaaaggctcgatgccacttgcctatg173484236719242367225
181664acaggccaatgctccatctttcccctgggatctgtttttg193204271497742715014
181665cccactcactttgggcactttgagcccttcaagcaagtca233334305998343060028
181666gggttgtctcgtgtgtgcatgatggtccgcgtgacattta142974317933943179366
181667ttgtcgtttgtgtggcttccaggagggcagaggcagtatg182154408921444089249
181668tccaccatcttggaaattctttttgtgttgtgcgtttcatcttc163524491043244910463
181669ctgttaatgcccagggtgctacgtgccaggaacttcacct163024589065145890682
181670aaaccaatcacattctgggaagccaaatgcaaaggggattct163544675508646755117
181671tggccaatgagacgtactggcccctgccttcttactgtgg161984767289547672926
181672tggtgagtgctttccaggtgtgagtcacatgcagggaaaaa183974824565248245687
181673tgaggcttttccaccagtgagacagcatgaggctggtagc132534840544248405467
181674tacccacttccatcccttgggtatggccacagcagagcag202784935792849357967
181675ctgggcctcccagtagacctcccatagaaatgtgggggaga182865030841350308448
181676cgatccaactctcccacacagctgcagtgtccgatctgtt162625117906251179093
181677cggccattcccctgtaataagggcctcttgtgatgtctcc223565210372852103771
181678ctaggcctcctgccaacagtccacttatcccgtggtggtt233175281164252811687
181679aaatggcagttcccaggttctggatgcttaacagatggtgga173925377012553770158
181680gtgcagggctccatccttagggaagggagtggatgctgtc153285474511554745144
181681gtgacccccatcaatggtctggacacagcagcattcaagc202175540578655405825
181682tctgcgtgtcaagggaaagatatgctctggctgccttcaa152365629750656297535
181683gagcggccagtctgtaccttctgcttgtggtgtcgtggtt193615717363757173674
181684catggacactccgactgagcttggctgtcaatgagctggt222325807072458070767
181685ttaggacctggggagcagaacccatttgctgcatgaatgt163445902086859020899
181686tcttgatctcaggccccctacgcgcacacacacataagaa153495976789359767922
181687gcctgtgattggaggaaaggcttgcacaggctgaacttcg183686055198660552021
181688gggactcagggtgactcctcttgagggaagctgatgcattg192226096608360966120
181689ggccgataatggtgtgacctgagtcccctcttgcaacacc213736179757761797618
181690attccatccttgccacaaccgcccatcactgccctaaatg193776259149362591530
181691gcttcccttcaacgttccaccctgtcctaggggaggctct173776308854063088573
181692agccccttcgtcttgtctcactgcaggggacgaaaacttc163476384203663842067
181693gcgggtaacagctttggaagggctggatgtgcagagtgtc223936479443764794480
19CAP19Eagctcgctgggaacagagtccgatggctgtgggtgtgtat163705603071656030747
19CAP19Sgcccaagggaatttgtttcatccggaaaacaaaggctacg1527134832533483282
191696ctcagattttgcaaagacaacgtgtgtcgggttgggattaga1828742522004252235
191697ccaacagaagccaagtgctgggcatttgtttgacaatggaaa1431643083004308327
191698ccctgcttctgagccaaagtttgtgcgacaacatctgtgc1428146245034624530
191699tgttttcatgtggggtgtttggagtggggaaacctcagcac1636456099825610013
191700tgatttctggaagactgcctcattgttagcattgattccgcatt1736965306566530689
191701aggatccccgaattgctctttgcaaagcattggggttaaa1926573640947364131
191702atgcccaatgggaagaacagttccaaatgcagaaacacacc1530280804408080469
191703tgcatgtgatgtttgccaatcagatcccatggatgtcagaa1537383696388369667
191704tggggacacagcatccattacatttctcaccgggttcaca1920091806609180697
191705ctggcacacgactcaacctcatgggcttggcagacagatt1838599748019974836
191706ggaagctcccagagtgcctagactgaacactcactggggtct171451080353710803570
191707tctcctgtgccttctgtggaccccaacacattcaccattg212001154000811540049
191708gcattgatgctaatgcaaatgaatgcacctggctgaggaaat162331252844212528473
191709agttcccagtgtggctggattgggaaaacaaggagatgaaga153401343697613437005
191710tggcctttaagggctatccaaggcatccccgaaaagaaat213121412446214124503
191711gaagacagctttcccctccatgctccctaaggggacttca162031479226314792294
191712aaaaggccttgagcaggacagggcaggaggaccagaattt223441570526815705311
191713ggatggcagctaagggaagaggacaccaacaccagacatga173401654898916549022
191714gggctgatcccagaaacatcaggttccccctttttgctgt163621752162017521651
191715tttgcaatggcgttctgtttgcaggccattctcctcaact192951846745318467490
191716tcagctttagggaaaggcaagggcattccccatgttcatct182341935435219354387
191717cttgacctgtccctcccttggctctcccatacctggatgc203102008015420080193
191718aattctccttccctcccacacacatccatcacctctcgttg182202073025020730285
191719gcattctcaaccagccaacaattccattgcttccccaggt152812127759121277620
191720acgatcaaggagggcttcagcccatacagagtggccttcc173642212919122129224
191721tggcagcttgtttctgcctatgctctgttgctgctgtcct153432308717523087204
191722gcctcctcatctgtgggaaactcaagcccttccttcatgc203852385110123851140
191723ggggaaggtaagggaatcacacatcctggccacacatcagt163252457602124576052
191724accccctcaacccttgttctaaatggagctggaggcagtc192872533063625330673
191725ttccagagagcatggaccaaatacggacaggatgggagga151682629840426298433
191726aacaggcccccagaagaaatcaccatgcgctttatgtgct172982700122127001254
191727ccacagacatagccccttcctcccctccactgaatattgttg183282776761627767651
191728ggctgacctttcctacctggaaagccaggaaccttgttgga151752875800328758032
191729gcgatgacaaggacaacaggataagcaccttggccttgga193622941666229416699
191730tccatctcaagtctgggttttgggtttggaacatgagacctgaa153083017376030173789
191731atgcccctgcttttacttcggaaaggccagaaggtgcttg163523090268230902713
191732gccagggcagtgtggtagatttcccaaaatttgcctttgc191573158771431587751
191733agctcctcgcgctgtaaaagagaggcgcgtagagagttgg152633242038232420411
191734tggccaaaatggatgatctgcgaaaagcccaaggaaagtg163083320531033205341
191735attttccagcctcctcgtcatcgcccaatttgaactgttg203933397484733974886
191736cacacaccccttgatctccaagacaccctcaaaacgcaca202393492391534923954
191737gggcagatggatgtcagtcataaccttcgtgttgcctcca153643589944935899478
191738ccttaccaccctacgccaaattgttggcacgaagaattgc213643664516736645208
191739ttgccacccgtaaattctccattgggggtgagaagggagt212813763610537636146
191740gcaggcaggtaggtggaaacaccattgacccccatcagtc222923841099738411040
191741caggggattgtggagccttatgctcttggtagcgctcttg153413916205839162087
191742ccggttcctcatgtgtcaaattggctcactcccacttcct163994004830440048335
191743cattggtcaaatgccaccaccggaagcttctggagcctta172834050235740502390
191744tgcaggggtcagtacccatactgccaatcacccagtttca212424136991241369953
191745tgggaacttgctttgtgtgggtcccaggcaataaggacca163664202662542026656
191746gttgtttgagccccagttcctggggcaaaggttttacagg181994283824642838281
191747caggactgccgcttacttcctcaccaattgttcaccagca153874381882643818855
191748tgtccagcattctgctgcttggggctagtcacttcttgttca172574460543044605463
191749tccgtggaatgcatattaggaaccactgcttacatccctgttca153724512080045120829
191750cagaccttgcatgaggcagatgcaaccttcaaaaatgagca163984599346145993492
191751aaccgccagtggtttcaactgtttggtggacagggaaagg213614648546446485505
191752gacaacatcgctgtggcaatttctgcaattctttggtctcca192974739553047395567
191753atacgacacctcaggcagcatatgttagtcccggggcagt182054819170748191742
191754attaaggcggcacagtttggtgctgatttgcagcacttga183764914767349147708
191755aagggaacagtgatttgcttccgtcagggctgagctcacaga163185009537850095409
191756cgcctggacttgatctgttgacatcatgctgaggcattcg152515069683250696861
191757tgcccatttctcaccaattgtatcggtacctgggacacaaag183755142213051422165
191758ggggtcgtcttcttcactggtggagcaagaactccgtcaa202355242151852421557
191759ccttcttgcctccatcaacctggaagagtcccaatgtcctc213685319399153194032
191760gaccattcactcacgccaaatcctgctgcagaagaaacca162815412325454123285
191761ccgttggctgcaggattatttcggaaggaaggagatggaa212945503667055036711
20CAP20Eccagggctgattctgaggagcctgtcctgtgtgcacgatt163626074929760749328
20CAP20Sagctgtggcacactttgcaggagtttgggatgggctgttc1933435884823588519
201764ttttggatccttcccaccaggaatcggcctgactccaaag1639645618184561849
201765gcccgtggctagagttatggcctcagcttccaggacaacc1820055322355532270
201766cgtggactctggggcttaaccactctgtgcccaaggtttg2339764080356408080
201767ctttacccccagctccacagctggcccggttttattttca1634273685407368571
201768tacaccgcttgatggagagctgaggcaaatgaatgttcca2218482841398284182
201769aaaaggagttcccggagaggttgatcaacattgtgggagga1926788244398824476
201770cttcaagttcctgcctttgcgagccaacaatgaggcaggt2336596927499692794
201771atgccttccaggagcagtgttgtgtacatgcaggggaagc232961038800010388045
201772ttccttccccctttttcgttacaggtatgtgggcagcaga153741134805611348085
201773cctcgtgtgctcagctctgtctcctcgggttcacacatca233941232746612327511
201774gggggttcaatctcaaaccatcaatgcagggtccatgttc183981316692813166963
201775agggtctggggaggctaatgggcaattctagccaaatttcaa152321367692213676951
201776tggactccctactgtgccactgcaattctgttggagaaaatgg153751451286314512892
201777cctctgcctcacacttgctgcgcgtcctttttggtttttc203521545209115452130
201778cgcatgtaaacaggcagcatcccacctctaaacccatcca173711605646416056497
201779tgcaaattttcatgggccttacctctagcgccaacctctgt172781686155916861592
201780gcccaatgatggatgactgatccacctatgctgtcgcaaa151261745918117459210
201781tgctctggggatgtttttgatcctgccaattcttggctaaa163801829942618299457
201782gcattctgccaagattcagtgaaagcacccattcgctcagt152791897997218980001
201783tcctttggatatgggaaaaacagacttcccaacagcctcctg193331965549819655535
201784ggggcatctgcacctatcatgcccaaagggattatctgacg164002025566620255697
201785cagatgccatggatttcacatcaccaggctgagccatcta163652106550821065539
201786taccacggaggtggtgacagatggaggctttgcctgttgt213982181626721816308
201787ttgccagaacaaggatggtgagattgggcacagcacctct243402257728622577333
201788gaagcgagcacaaagctcctcgcaagggccatatgtgata153362345631023456339
201789aatggcaactgtgtgggttgtggctggcattgagaaaaga193602440875824408795
201790ttccacctaggcccattttgtccccacaaagaggaaaaattc193112530658825306625
201791ttgatgccttttcagccaaatccattttccgacaagcaaa173312604992526049958
201792aatccggtggggttttcatagtggccagtgaaccattcaa152502695421026954239
201793taggattgggttggggagtgccgtgggaatcgtaacatga172022781910227819135
201794gtgtccacatcggaaccagatgcttgagggtgcagaagaa192302875786628757903
201795agggaggtggtggttcaagactatgccaggcaatgcgata172972975770729757740
201796gagcctgatgcccatacacaccctcctcaagggtgtgaag181253021437930214414
201797ccatgtcaacattggcacctttgagaggagagcgataagca233853100423131004276
201798gtctgcctgctatccccttgtctgggtagctggtggtggt182613167196731672002
201799caacagggcacaatgctgtaaaggctgccctgctttgata151383215796732157996
201800tgcatgcttccagataccagaagcggattatcatgggcact173733299049532990528
201801gcccacatgattgctgaagatgtcaggagatgcttagctttg153963342927533429304
201802ttcttggcagaagccctagccccaaaccttgtcctcaagc193683429922534299262
201803cacccttcgggtcacctttagcaggaggttatgccctttg203253528186635281905
201804aggctgcaacgctttgttttgcccaaggaaatccattcac223903612642936126472
201805ggctcacccagtgtcctttcaaggaggtcaggccaatcaa152943703794137037970
201806agcaaggaggaaaggctgtgagggagggggaatcacactt172003789256437892597
201807ttccattctctgcagcgttccttgggcttgagtgggattc193273856282038562857
201808gcattggcctctccatcttcaaggaggggcaagagtgtca173143937220639372239
201809agcaccgcaaggttcattcttatgtagggggccacacctc192793978401639784053
201810caatcctgattccccacgttgacctcccacctcgagtcac173204056624340566276
201811gaaacacctccccagcagacgcgtaccatgtgaacgagga193184079301840793055
201812gaggctcaggtcccagcttaagatacctgggccagcaaga143304170832741708354
201813aaggcaggaggcttccaaaggcttgcagagtgggtcgtc192044263281342632850
201814accgtgtggctgatcacatcacaaccctgaggatgccagt172454342775543427788
201815cctaatggggttggtgaggatccccaggtttctaccagga192614437010844370145
201816ctcgggcttgtctgaatgctggcaggcagtgacttcacac223924524643645246479
201817ctctaaaactgggcggcatccaaccatgcctgtcattcgt201594608101546081054
201818tggggctcagaggcactaatctccctcctgagggttcctt182134690678046906815
201819tccaatcccctccatcattctacctgcccaggtggtcttt193814760590847605945
201820atgcatgcgcctatgtgaacagcaacatggggccttctaa153004854631348546342
201821ttgatgcacatggtggtgaagcaccactcccagctattcc163494953909649539127
201822tcagagggctactgtgggaatcccatgccatgagacctactg173795037338350373416
201823accctgggcaagctaaacaaatgctatcccttgggggttt221335129526151295304
201824cacaacacccctccttccatttttagagcagcccctttgc173185207960452079637
201825attgacgacgttggtgttggctgcatctgagtgggtcctg163665267170352671734
201826cgcgtttgggtgtgtattgtaaagggacacaccccagaaa151745358187153581900
201827tcagcaaggaccacagcaatagcctggatgctacagcaca171895422724254227275
201828atttgcgcctcgaatgacttggatttccttcctcccaacc161585495328654953317
201829ttggtagttcccgcatttccagcacggccagaaggtaaaa202545591958755919626
201830catgtgtgcaaagcccctaaacactggtcacccacgtcac243665684028856840335
201831ccccaaggaactccctaaccccctcaaatacaccccctgt153435767648957676518
201832ttggggacatgtgtctctgcgcggtaccagctcttgctct211255864276158642802
201833ccccctgtgtacccttttcagatccctgggctaggggtag181885923589659235931
201834aagaccctccagctcagtgcgtagggggtgggaactcctc153395972968259729711
201835agccaggcctcttcgtacactggtcccttcctgtgttcct151246036262160362650
21CAP21Ettgctggacacccatctcacgggcaaacagtccagaaacc153665286075952860788
21CAP21Sgcctggctctcaacaatcctagggtggaatggtcaccaac1633049421354942166
211838acacgtgttggaggcacatcatctcgggaaccactcctca1622354291575429188
211839atgctttgattcccatgcaaggatggggaatggaggttgt1638461365116136542
211840accatagcccctgggatctttttggttgaattgaaagggaca1633370432597043290
211841ctgcccatagcctgaaggtccacaagaccacaaggacacca1923179966347996671
211842tttttcctgagcttttggtgaacatcctgctgctcctcaca1516688865198886548
211843aacctcctaagggccagagccaacagagctggccatgaaa1936498281569828193
211844tgaggtcaatgaaatgggagaagtggggatttggagcattgt162861024603310246064
211845aagcaatgtggggatcttggtcccttgtcccagagtgtca153911114501311145042
211846ccagctacattggcatggactctttcagccccaaggagtg153681212034112120370
211847tccgtggaaatctcctttgcatgaactgaggcccgaagaa163071292597512926006
211848ttggcatcagcaggatgaactgacaccaagacagagcgact153471377071713770746
211849ctgtaccttgggccagttccccatccaaaggcagaggaaa183671438246614382501
211850ccatgaaaagggctcttgaatttcttccttttgcatgctgat183541537289115372926
211851ttggctttgcttccaatgtgcctggcaacgacaaagttga213571617488716174928
211852gtgggggacatggataggaaatgggtggcatctctttgct223271663439516634438
211853cccttctccccctcttcaatcccaagctaaggctgacctc163381760107417601105
211854ctctgggcatcaggaggttcgcaccaacagtaggggatca202921804575918045798
211855ggactagcttgccctgcactgtgaaaggcattgcccaaac211401868446718684508
211856ctgcatcctcgagttcatcgtctcccaatcatccccaatc183521938674019386775
211857attcccctgcagattcctcatgctccattccacttgttgg153361985162319851652
211858tttttgatggcagagatgagacaaaatgccatccagttgtgaaa173832063110020631133
211859ttggcaacatgcctttctgtaaccattgagctcttgggtca173762117609321176126
211860atggcttagacaggcccagacaggctgcaaacaaccacat182712214157622141611
211861aggccaatttccagcccttatgccatctgtggggatagtg153812256804122568070
211862ccacaaatcctggaagctcacattgtcatccagcctccac212302348313223483173
211863ttgggtgttttgctgactgggcagagaaaagaagccacagc203562442911024429149
211864tatggaaagcctggggaatgggagacggccttgtatgctc181442527915725279192
211865gccagaagcaagcaggatctccccacccttgctctcatag193622600665026006687
211866cttcaaccagcaagcacagggtaggggctgggcctatttc173072633573526335768
211867gagggggagatccaggaaagaatgggctaggaaaggcaca103732654689526546914
211868actttgagtggcacggcttttgcacaatccagttgtgtgg102932743476127434780
211869ttcgggtgggacctggtatagccccagtttaagcatcca151002836800328368032
211870tgctccagagggttgtgaaaaagctgccatggactgatcc153632899355228993581
211871ttggtggagctaatggctgaggggtgggtttgtgtgagta163332995644229956473
211872aacgctctggtttggaggaaacatcattgcaagcctgtgg202983044405930444098
211873gcaacccaagtatccgttccatacgtgcacatccgtgagc162453104893731048968
211874tggggaaggggattatgagaagggcaattcttgcacctgt173133186325331863286
211875tcctgattcccaaggttgctcctcacgtgaaagagaaagtcc161913234174932341780
211876ccacgccctgaaaagagttccctctccccagcattctgtc163093318452633184557
211877ggaatgagggacctgtgctcgtcgggcctgggaatatgta163213385052933850560
211878cgatgatggagcccactacagctctgggaattggatggat173953469958334699616
211879ggctccggaagctctctaaatggctgttctccaagctgaa153723507904435079073
211880tgcattgacattgggtgtgatgcgtgccaaaagagaagaa143083559814035598167
211881acaatgggccaggaaaaagagcccaactcttagcccacac212143659209836592139
211882cggtcttcatggcttgttgaaggttcttcagcagcattttct173793721382637213859
211883cactggctggtgggatgtaacccacagaacagacccaaca172983804881738048850
211884ctatcttgttgggcgtgtgcttctcagcccccaacctcta143653878801138788038
211885ataccatttgcccctgcttgtgcctgaggtaagtgcatgg161273978495839784989
211886cccatcaagcatcctttcctatggggaagcctgttcattt153554051550040515529
211887cagactggggtcaacgagtgggcatggattgtggatgaga153274097351740973546
211888cggggtttcctacaaatggatcttcgttccactgcacaca203924196346141963500
211889aacgcacctccaaagcaaatcgctcaccatatcccacctt202594270536442705403
211890gatccctgggtgctggtaaattgagatctcgaagggcaca173754364788243647915
211891tgcaaaatgaggctggattgcccaccattcccatttccta171904435219644352229
211892ttcccactgctgtccagagatcccaatgcaccagactttg233854510234845102393
211893ggcattatcattttccccagagcccgtgttcaatatcagctt203994565893945658978
211894gcaggagtgctgagaagaatcacccctattgaacagtgaacca153504627450446274533
211895ttgcagtgacttccgaaggaattctgagcctgcctcttgc152154670016446700193
211896ttcaaggattcgacagcacagagtcaatggggccaacaac172994737135347371386
211897ccctaggctccgtagtgtggtgcattcctctcaagggttt183684819816148198196
211898gcaacttgaagggcgactttaggccttgtatctgataggcatt173404905702049057053
211899aagttcaaggaaggccacgaattgggtcgacgtgtcagtg213624998371649983757
211900tggctggatattgctcatggacgacagcactgagctagatgt172175085752350857556
211901cctacgaatgggccaggtagttgggttaggtggctctggt162605179114451791175
211902ttgtgggaacacccacactcgcccactcatcaatctgcaa162355272978452729815
22CAP22Ecatctggtgcatgcaaggtttcttcatggatgggattcagg203676274558062745619
22CAP22Stgacttgccccaagacaatgtgataaggccaacccaggag2419837466533746700
221905ccctttaacagtcctccagcatcaacagatttccgcctcct2031247349994735038
221906agcgggtacatgcactctgatagcccatacccccatcaac1637954803575480388
221907agttgcatgttctccgaccatggctcatgcatgcttaggt1638761541406154171
221908atagggcctcctgggacacttgcattgtgcaggcttttct2031869881976988236
221909tcgcttaacccttccctcaaccccatgaccactggattct1622879456427945673
221910caccctggtgtgtaggagcaccatccaccaccctctggta1739589272858927318
221911tgacacaacagggggttctgctctcaagcgacagcccttt2117395212449521285
221912ccacacccggacctacattttctggagagcctggggaata193931051697910517016
221913gggctgcatcctagtactgcttccctgtgctcaacaccagaa173221150736611507399
221914caaagtgctgtgccacttccagcttgggctccaaactcaa223071235939312359436
221915aagaacatcttgccccaggacccttcatggattgcacctt202751332073513320774
221916tgaaaggccctgccttattttgggaagggcaggacagatac183011375055213750587
221917ttccgtttactgtgccaccttctagatgctggcacccttcc173331433406814334101
221918tctcacagcacttggggaaatgtgtgcttcacccatagcc142871452152014521547
221919gggccatctcacagtgtcaagctggctcttgtgcttgttg151161541800815418037
221920tgcatagccctgttggtgtcgatcaaccctgcttcccaaa153791625048116250510
221921ttggggtgagaccagaaagaaatgcaagagaggaggccttg202271665360616653645
221922gcagttggtctcctcccagaaaacagattgctcccaaacca153691748109717481126
221923gtgatggaaagcccagaaggcaggacctgtgctccacaaa222961821047418210517
221924cgcatgtaccctttagccaattgctcaaggggaagatcagg162771919013119190162
221925cctgtggtcgctgacatacctcaagggccaggagaagaaa203951990727719907316
221926atggatcccagtttccatgcatcccaggacccatcacttg202702080351520803554
221927catgaccagatccctcaccaaagcaggcgaaagagtcagg171372158341921583452
221928aagcgaagacaccaggaagaatggtgcctcagcaattaacc163632226507222265103
221929gaccttgtgtttgaagctggatggtggtacttgaggcatgg183562293624822936283
221930tctcggttttatttctccttgctgcatgtcagtgtgggtgtt163092389060523890636
221931ggcatgtgcacaatcaatcccccaaacctggaaaggaaca191482473107324731110
221932cccacagagtcaagatttgcattttccgctccattcagccta202882566061625660655
221933tatcttggcgctcattgcataggcatgtttgcattcacca153192649603226496061
221934ttgcaatggccaaattcaagcccattgtggagagggagaa162822692309726923128
221935attgggggtaagggcagaagcgttaggtggcccacatctt171132788642727886460
221936gggtgtggacataagctggaccactgtgatggtttcccact163952864011328640144
221937gcaatatttccccctgcaaacccaaggcatgcttcttttt153002957602329576052
221938atgttggcaccatgggaaaggatttgtttgttccatctcca152552970389029703919
221939caagcctcctccaccagaacccggctgaggtagcaaaatc171943065807030658103
221940agtttgatgccctccagctctgcatgcatcatgatttgct202263158270131582740
221941gccgcctatcacgcactatttcccaagtgacccctacacc243633252261832522665
221942cctgcacccatcttccctactggaagtgccatcatttggt222373348211233482155
221943ggaattggggatgacacacatggctatctcctcccactga173733420685434206887
221944ttggggtggtcttccttcactgggcagtgattccagagaa153073502288135022910
221945ccacagagtgctccaactcccccccaaccatttcacactt162373558047335580504
221946ttgggaatcttgggttttgcccacccaagaccttgtcctt173663641436036414393
221947atgcacctcttgtggggtttgccaatcactacgtggttcc173593741345937413492
221948tgggctttgcaaggctaactgtggtcatccacagcctcct192923826184738261884
221949tggaaagaaatacagcctgctttgggaagttgccattaaccac202113889352938893568
221950aagggacattgggatcattcaggcccattagagtggtaggg203893962535239625391
221951tgcttttctgcgacgtgttttgttagctcaggcgccctat173744034423440344267
221952caccccgaactgaactaccacagcctagctatggggcttg192164119004341190080
221953ctgctggtcaggcacatagcctggcttcagtggctccttt161864218290542182936
221954acaaggaattgcccaggaagatgattgttccgagggctgt161714271069642710727
221955ggtcagggcttcaggtatgcttttggtcttgcaggtaatgg153434334974543349774
221956cagggccacttgctcatacaaggtgggtcacaggaaatgg162124392625043926281
221957cgtgacttcatccatgcacttacaaggggcctgatcacatt152984489312444893153
221958tgggggaaagagatgtagcacaaatccaagaagttgtgatgg184004582560145825636
221959ccaactcctggggcttacagtgggtggatacaaccgtgtc221914656031846560361
221960gggctgtttgttgtccgaatagtgcctgtcccatttttcc213904713331547133356
221961gggccattttggtgtgatttgcagaggctgaaagccagtt173934811553548115568
221962caccacgttggtgaaaaggagagtggctggcttccagtct173384909977449099807
221963tgcctcttcactggatgctgtccagtccatttttgctcca153915005534650055375
221964gcagcaaggattccatttccggagctcattggaaggttgg192615089172350891760
221965atgctgccactacccaaggttgggatggggaggaattatg193055182123251821269
221966tggcccttaagcatttgagctggctttctccaaatcaatca163415274465752744688
221967tgctataggccagcaaagcagcatggggcttaggattgtc182635371712053717155
221968ccacctctccatgcacacttcagcaaatcccatgttctttt162935421360254213633
221969tcgaaacagacccgagtgaacttcgtaatgccctggaagc203615517122955171268
221970ggctggcatcatcatcactgccaggaggcaaactgacaga153875583925655839285
221971tctgaaaaagaagttggccatttgctaattttggttgccccta202885646843356468472
221972tgtaacctcctctcacccacaatggggtaagtgggagttctgt213045709787157097912
221973atttcccaaggcactctccattgtgggctgaattgacagg172795782140057821433
221974ccccgaggagtctaggcttttttacgttgccttgccttga151755872288858722917
221975actttttcctggccctccatggcccttgaaacaaaatcca182695942247459422509
221976tctgcacctgctccttgtgtgccataggttgcacctgaca181756040176860401803
221977ggatgtggcatcattcgtgtaatctgttggcacccctgat163026134100761341038
221978gcccatctaggctctgaacgcaaggtggagtgtgggacaa182356227034762270382
23CAP23Ettcagtcctgggggaagaaaaaagcatgacatggcgaatg172645543736855437401
23CAP23Sataggctgctggacctgctcgcatgcttcccttctccatc1934651911325191169
231981tgctgcagctgtgctatcctagccacagggaagatgatgg1829757602505760285
231982gactggctggctcatctgtgaggggactttgggctcattt1218166895376689560
231983acagctgcctgctgaatgaagggtgccaaaatagggcata1820676284727628507
231984agtccctagcaccaccctcatgtgtgttctttgggcacct1727185157838515816
231985aatcccaccctgtgtcatccaagcctgcttgggtctgaag1611894435139443544
231986gctttaattccccaccaccaatgcacatggaggtgacagg172941032766310327696
231987ccacgcgaaaagctaaggagtcactccgagttcccttggt193901128699011287027
231988cctcagtcaggggcataggagaggttcttgcaaggctgct214001217052012170561
231989acgcatgcacctaacacaggaacctacggaggccaacctt192301262287112622908
231990gtgtaagggtggggctttgaagctggaaacgggtgcttta152621360412713604156
231991ccaacgggctaacagcaaatgagtgggggtttggaacaga183341458426014584295
231992cgaggcaaagggagagaagagcgctcgattgacaaggatt222901557642615576469
231993agccctagtgtcagcccaaaagcaaaaccactctgcacca173611643068916430722
231994tgagcaccaagcaacactgaaggcctacactgtgcgcttt172311739109117391124
231995aaagtgggaccctcaagtgggacagccccaggtgtctctt172971836059118360624
231996catcctaaccgcatcccagtttgacccaagcaaaatgctg163911924255219242583
231997ccaacccatggagggtgataggaagcttatggcttcttacgc152722012371020123739
231998ttgcccaggtccagtttcttggctcaggctggagtcattt192792090092020900957
231999gacccaagggtgtcatctgggctgggggaagatgtgagag182302175037021750405
232000gcgcacgtgtgttgtaattggtttcccttccatggtttgc153922237488622374915
232001cttggatgtgcttcctgctggccccagaccatgttcattt231212314540723145452
232002accctgtgctgccagaagttgccagccattctggataagc202182396726623967305
232003ttggaattgggttggatggttggcaaccttgtgttggttc203322491838024918419
232004caggcttcttccctgaggtgtggctgcttcatcagcctaa191152543747125437508
232005cagtgccaaggacaattggaaaagggggtcaagggctaaa192142623017226230209
232006aacgggggagaatttgcttttggcaaggaagccaataagg183782718981227189847
232007gctaatgtctccggcaaagggtactggcttacggccttcc163932793368327933714
232008ctctaacgacctgcccaacccatgggcggggtactaacat162832868606828686099
232009cgtagagtgccaggtggtgactttgaaggccatcctttgg163652940777129407802
232010ctatggtcacgcaccttggactgcaagcacacttgctcct163423005092630050957
232011acctcccacaggattcctcatccgtcttttcaggcagagc213883100876331008804
232012atcagctggggtctcaatgccctttgatgggggaatttga203643194662031946659
232013ggacaccaggccaaagtaggcccatccagcagaggtgaat152263293978932939818
232014tgggtgaaaggcatttgagaccaggcttgctcagtctcct183593381427233814307
232015gcgggtgttgttgtctgatggacatcaacgatgccaagga163723477317434773205
232016agggaagctgagttggtggatggcgtgaggtaaagctcct152873529558535295614
232017ggctaaaaggatgatggcaaatctgactctttttgggatggtg162323590845735908488
232018tggttttgggcaacccttagatcatctggccaaagcctgt173823677604136776074
232019atggggagaaaatcgcacatggcttcttcaatggacaaaggt183413741638537416420
232020cggtgaatcttgctcctgacaagtgttcagggtcatcgagag152923797135437971383
232021cctcagagtgccgagtgatgctgtagggtttgggggacaa153043893308438933113
232022ggactctggatacttgcccatcgactggcaattcggatgtga153493979770939797738
232023ttccctcccaccgttgtatcaggctggtggagaaaggtca233244067702140677066
232024ggcatcgtgatgacaccctacatcgtcccataagcagcaa173924148025441480287
232025gccagttcgaacaaagcaaatgcaatatgctttcaccatca172724235792342357956
232026tgtgtgcaggaaccaaatcccttccaccttttgccggata211854313630943136350
232027tgcagaattgcagctatcagggccattatacccgaagcccta153874408640544086434
232028tgtgtcacccagttcccctatgttagtgagggggcaaagg153414462794544627974
232029aaatgggaagggtcctcgatctggcaagatgagcaagtgg182694523490345234938
232030gggttatctgttacgagccaagtgacaacacttcgggctatga223334620013846200181
232031attcgggcagtagcaggtgtggtgtgtggggacaatgatg183454707735047077385
232032tcttccagcccaacgaatcttcagcggttgagagtcagga182954748458847484623
232033cccaacaatgcgttctggtagttcctgtagccgaggatgg173804845948348459516
232034atgttgaaggaacggggttgcaacaaggttggaggggtgt193784943434649434383
232035gtgatgcccgtggtgttatggaccaacgttcaggaccaca193915014015350140190
232036ctggaaggcagttggaatcaaaccagcgctccttcagaaa192495111204851112085
232037tccacaagcagttggccttaatgcttgctccagaacgtga163705189619351896224
232038cagaaaggtgctgggggtaacatggcaaccacatggagtc162925242113252421163
232039tggtgctgatgttccctttgtcggtccttgatcccagact152365291648452916513
232040tcaagccgaggattttccttaccgcaggagacagcatttt192135381246053812497
232041ttccagcctccttttgcattctttgggctccatgtcaagc193955465875354658790
24CAP24Eccccagaccaactctcttcgcgagagctgccaatgacaag151635016198250162011
24CAP24Scagccatagttcccccttgaggggacttcaccaaaactgc1738533924033392436
242044gtggtgccgactattgctcaaaggcatctggggtctgaaa2019640234544023493
242045tgttcacagcatctggcatctgcctttcaaaaccggaaac1537748212714821300
242046gtccccaaaaaggaccgattttgaggagcaggaagagagga1639056966765696707
242047aggcagtgggtctccacctatcgagagctttggctgcata1739765827056582738
242048gcaaagcacccattgcataatgctgtgtggctttgtctca1632070424707042501
242049cctgcacgtggcttctagtgcagacccaaagtggcaaaca2131077737737773814
242050caacgaatatgcctgctgctcacataccctcccgttgtga1635381220848122115
242051gcataatgctccatgcgtgtggtccacttcgagggtcaac1634291061339106164
242052cttcgtgtgcatgtgtgcatgctcggccttgaatgttttc1828399590069959041
242053agcagcttagcccactggaggggcccaaatcataactgct183441090955710909592
242054tactggaggcaggcaagtgaagcacttccccagctgtgat213091109942611099467
242055tccttggcatagaggaggaaaatgtgtctggtggcctgtg221421203446912034512
242056ggtggctgtacctgggagtccctggatctgcagtgtcacc193401274990012749937
242057cagcaaaaccagcaatcacatctttccatttgtgcgtgaa182751350609513506130
242058ttgaacgatggagagcctgaacgaaaactggcctgatgct193861448979814489835
242059tcgctataacgtgttgctggtcatgcccaactgaaatggaa163941539332315393354
242060actgcggtgaatctgcctctgcccaaggagaccaatgaag224001611198816112031
242061ctgcccaagcatgttctctgcccattcagtgtgggaacaa213591692167216921713
242062gtgggaagaattgggcagagtgataccttccccaggacca183891776266617762701
242063attcctgccaactcccctttggacaaatgtggcagctgag173441873178318731816
242064tggtctggaacagagcaggaggactattgatgcccccaga233891923190219231947
242065tggtcagttggaggcagagaccatgtagggacaggcaaca172112016928720169320
242066ggatggttttgaattcccatgtacagtcaccccgatccttgt153872083293520832964
242067ttagacgcttccaggccatttggccaatgagtcaaaccag173092179688721796920
242068tggagcgcgtacatctgagtgtggcaattcctcctcttgg163952262517922625210
242069cattccccagagaccagcatttcaatgccactgcctgttc153832321453823214567
242070tggctccagctgacctttttaagggaaccttttccccaga213502409998024100021
242071ttggttcccatccaatctccgaaattggagccagcaggac152612488076124880790
242072ggagcgagccttaggagtgacaaccgctcagcactctgac163802583670825836739
242073cctgggagcttcaaaagtgcgtgctgcgttgagtgtaggc223162662139226621435
242074ccatggaggttgggttatggggttgtgccaaggtttgtga173262720346627203499
242075gtgtcgggccctctgtttaggaccaggtctgccacattca203292805052728050566
242076gatggccactgctcctctctccgagtgaatgggagagtcc173052904620929046242
242077tccccattctgtggcttcttccagcgaaactgtcgatctg153912975246229752491
242078ccattgccagggaaatcaatggtcatttcctccagggttc182013065601130656046
242079ccgtgctcacaactgtcctgatgtgggcactcacacacct193823162897531629012
242080ggagaacacgggcctacaagatttccggggacgttcttct163193253135832531389
242081tgggtctcaaaaaggccactaccctcaacaggaggaatgc163323346314333463174
242082ttggtccagcagacatttggagtgtctgcaacagggctca233003444929434449339
242083ggcaatgccaactctctcaaccctctgaaaacccatttcc183783523695635236991
242084gtgcccacctcagtatgcaagggagaagcaattgccaaag172783572875535728788
242085ggctctgcatctgtcagtgggtcatctgcgggttgcaata173713642042036420453
242086gggctgagtgttggagtgaatgggatttccttggatctgg192733704474337044780
242087ggaaaaatgggcgctaaacagccctgtttgcctcactacc192663786528137865318
242088gagaggccgctttacatgctctggcggacgttcacattta151763878568038785709
242089gagagggacatgccttccaggcgcagatctccagaacaga193663962465439624691
242090gattcgcccctgtcttcttgctatttgccacgctggacct233414045037940450424
242091ccaccaaagtctccctcctggaaatgtgcagccgttcaaa182334091334840913383
242092gagggcactgcctttagtggagggacgtttcctgctgtgt172224185159041851623
242093tcaagcattggcgtttcactgtcaacacttggccacgaaa203834278910142789140
242094ccattttccaaaccaggtgaatttggattcacccatgcaa191014361221243612249
242095ccctccccacatcttaatgctgggatccgatttcaattcc173724449006244490095
242096ggatcccaaggacaaaccaaagctggaaacaccagggatg183954491066544910700
242097tgcaatctctgtggggagtgacggcttgtcctttttcacc173744583243745832470
242098agtgcccagtgaagccaaattgtggccgactaacaggaaa152334657294046572969
242099ctagccaggtgcagaacacgatcagccccatttcctcctt153534740657147406600
242100ggcacagggggatcattaaagttccctgcaccgaggatag153354828633648286365
242101tccttgccaatctgcgaatagcgaacacatcacggaagag153744922050449220533
25CAP25Eaaacttgaccaccaccaccatgaagttgccggtttcctct201005405985254059891
25CAP25Satggcctcctgcatttcactaactagcagggggacggttt2438336813133681360
252104gaccacaggaacccaggaaggggccatgcttatcatcaca2019443374194337458
252105tggattggccctaaggattggaactcacatgggtggtgtga1830450958145095849
252106cctcttagacccccacgatgtgcaacccatgaaggcttag1617860010626001093
252107ggccaaatggggacaagtaacctcctccaccacacattca1612969316826931713
252108agctgggttctctcgctcagccctctggccacatttgatt1525279075917907620
252109gggaaacaggcaaacttgctactgctcccagctcagttcct1919587337328733769
252110cctagccagcctaccgaatgatgccaaactgtcagccaaa1936596140639614100
252111aggccacttttgtggtgcttcagcacgggatgtgtcctta163661032986710329898
252112aacacggcacaaccaatcagtgaacattgccatgatcgaa163281120367511203706
252113tagccattttgcgtgaatgcccaggcaggtacattttggaa152111192127911921308
252114catggaagaaatcggcaacaaggggaccagtagtgcctga183051286038212860417
252115tgtgaggcccaaaccagttacctaccagccacatgcttca203881367454613674585
252116tggccaccaaaagtatgtgcacttgggattgggattgacg202341458680114586840
252117gcttcaggtcatccccacattgcatcctctcacgtgacct223011538637315386416
252118tcccacaggattctgggtttcagggggtgaaatgcaaact202501621043316210472
252119ccaccttggttaccaccacaggagtggcatcagctcaaca192311694534116945378
252120tgggagtatgcaccgagatggaggaccaacaaaaccaaagg153621793061617930645
252121gaaaggggaaaatttcagtgccctcaggaccgctccatact173421881562518815658
252122tcgaaatctgcatgtcatcctttcctgcctgtgttgtagagaga173921963802919638062
252123ggcttgcaaagttcctgaccgggggacagaacagagcatc173592063012820630161
252124tccgacgagggaattacacccttctgcaaaaaccgggaac192812076270120762738
252125atggccttgggagttgaagatcagggcctggctattccta153872175577921755808
252126ttccaagggggagcttaccttggctgtggacatttcttgg202022248647422486513
252127taacaccggtagggggagaggttaggccagccaagagcat203812303437623034415
252128tggaaagagacgttggatggtgtgctgcctagacttttgc173572393798723938020
252129gccttccacgaacaatttccgcaacgaatgcgcataaaag212352446474224464783
252130ggacctcaggcaggacagatccgcaactacaactccagca193162511092325110960
252131gccccagatccaaaactgagcatgccatcctggaacttca203732572652725726566
252132tccctcatcctctgtctccaacttgaagctttggctcgtga163342671345026713481
252133tgaaaccatttgatcctgaagccgggatggagtctctctcgt173482724006027240093
252134caccaagctggttgtgctttaaagggcctgtcctgttcaa233352763225027632295
252135actgaaggacgccagaccatatttgggtgccgataacagg172012827819028278223
252136agagcctcacgttgggtgttagggagaagttgccctgtca203262916768629167725
252137tgtctgggaatggttggttgccaactcccacaccaagtga153373014275830142787
252138gacagtgtggtctgccttgcggtgagccacagatgaacga223583083639530836438
252139cgggggtttggtacctgttacatgggaaaacggacctctc173393143560231435635
252140tcaggccccatctgaagactagcctccagcctgaaacaag213103222810932228150
252141tcaaagaccctggttttccaatggcttagtcttgaagcactgg171893282604532826078
252142tgtgcattttgaccgcttttggctgagcttaccggatttg212853373099733731038
252143ggctcacagacctccaaaggacgtcacctcagccaatcct252013462474434624793
252144tggtgctgtctccagctcattggaccatccttggtgtgag183943510328835103323
252145ttttggattgccatcactgcgattccgcggcttacttttg163933597409935974130
252146cggcttccccctaaatttgttatgatccggggagaccaac173113695716436957197
252147actttgcaggagtggggctagtctctgagggggaaacgtg162963760903237609063
252148gcttgttctgggcaaggagaagggcatctcaaagctccaa191533851096838511005
252149gaaacacttcggggtgaagcgggagagggatgacttgtgc233893913970239139747
252150gccttgatcccaaggtgttcatgggaggtgtttccctttg213954009359540093636
252151aggccaaacttgcctaccaagcaacacacgcacatacacg152644071291140712940
252152tgagggaccgtttgaattctgcctcagaggcagttcgtcct153584163496441634993
252153ctgacccatctggtgactgtgggaagggcctctcagttcct193504257834442578381
252154catgggaggtcacagtggaagccctgggagtcatgctaac183114311031143110346
252155ccccagagtcttcaggcaatcccttgagaaaggtcgctgt183214386669443866729
252156accctcacactgggctttgtggaattccgtccatttccaa162594478601944786050
252157tgctgctgcagtggctttatggagtggctggttcttggag183974576397445764009
252158gcaaccccgtctacctttcagcgtgcagagtcatggatgt223414672476446724807
252159ggagctcattcagggacaggctttgcagctttggccttct192524747616447476201
252160catttgctttgaagggcagttccctgcccctttactgtctg183314825837648258411
252161gagtgcaccgttggcagtaatgtcccaaaagacaggtcgtc153324907195849071987
252162tgcttggtcgttgagtgcttccacgctaccaacctcacag163994954995349549984
252163acgcacaaaagcaatcttggttcagcgcctttagctcctc193965049029950490336
252164cttagcaagcagcagcagcacaactgcccagttttggtga172505098704050987073
252165atctcatccgatccgtcgtttggggaaactggcttaccac203265180571051805749
252166agcgaggacagaatccgaagagacgcagagaacgggagac192015263358552633622
252167aagcattgagtgcggtgagaatttgtgctggccttgcttt173265284455852844591
252168ggcaacagcgatcaccataacccagggtacagacctcctg133605350473953504764
26CAP26Eaaggctgggaagactggtcaccaagcagtgacattgcaca162534095399640954027
26CAP26Scccagatggggtctaaagcaatgtgtgggcactgatggag2131336117843611825
262171tgcttcctggggaaatgaacgaggctccgtcttcagttgg1838944406684440703
262172gggtggatcacggagcttacaagctaagcaatgccctcca1531750321315032160
262173ttgccgacagaggactgaaatgccatgcagacatgaacag2427455356745535721
262174gaaaaggccatgttgcatgatttatgggtggtcccctgtc1935363700686370105
262175cctccctcactcccacaaagaccctccccagagggaacta2421469316086931655
262176tgaagatgggggctgctagtctggctcatttgccacagtc1528377742627774291
262177aaaggggccactgtctttgactgctgttgagccgactttg1738287085828708615
262178gcactggctatgccacacatgctgggacttgggaagtttg1838590160099016044
262179agccccagggtccctaaatatcagccgttctgaaaatgga1438095447459544772
262180tcgccatggtaattgtgagcgcccagcaagacctctccta163301036689210366923
262181actgccaagctccctaatgcgagcttcatccaaccccaag233931134926511349310
262182tgggtcaagttccacatgctaatgcacctatccctcctcct173571226076212260795
262183tgcacaaatttggtgagcattgcatccactttctcccatcc212291319499813195039
262184ccaggtgaatgtgcatgcttgggcatttgatctcctccag173481380617613806209
262185ttcgcctaaatgtggggaacaagacctgcccgtgagtgat173851475054014750573
262186gggttccctctgtctggatgaaccaaaacacctgcctgct182931569540515695440
262187tggctgctagacaggcaaaactgaacactggcggactcag163861645122216451253
262188caaatctggtcccacagcaatcgctggcacttctctcttg183841722041117220446
262189ctgcatcccttgctgaattgccaatcctgggctctgtacc163281813635718136388
262190acccttcagggggaaagaaatctgtggtttttggagggcta193931899303118993068
262191gtgatggggacgtcacaagaattaggccagcagacccaga232651967898619679031
262192ataggccctttgaggccattggctgcatgagagtcactgg182442065546020655495
262193aaacagggtaaggcgtgtcctcaccgggaagcaaaaatct173412162451221624545
262194tttgcatgtgaggtaagggtttgtggaggcgagaggaagaga213002254912222549163
262195atacacggggacgcaaaaactgtgtgttcagcctgtgtgc203612354488923544928
262196cggtgggggtagaaatcaaacctttccacgctctttggac172372421510524215138
262197ggctgtgatgaatggacctgcctaccttgaccctcagcctta222202494688724946930
262198gagctttcagggggagctttatccttcccattggtgttgg193812567125225671289
262199tggaggttagggcagttgctcacagcatggagctgtggat223802609929226099335
262200agtgcagtccatctggagcagaatgtgcagggtgcagaag222042701404527014088
262201cttgaggtccatccatgcaacaacccaagtgtccattcca161532745196427451995
262202tgatgcaccactgtggaaaacgcctatccttccaccctcct184002801358028013615
262203gtgagcaccaggaggggtagattggcttcttccacccaga131902900823929008264
262204gctggggtgtctggtgtttccatgggagtgatcctggcta163992973064329730674
262205tgtccaacccatcagtggagcagtgtgacctgggatcgaa152603052068830520717
262206gtgactgcccttccgctagtgccaggacagcatgagtgag172133078151130781544
262207ccctttatcggagggaggaagccctgctccaaagtcaaag203623171148231711521
262208gagaatacccaccgggatgactgacaggagggggtagacg162213255879232558823
262209atggatggtgtgggaggaacaggctgctgggacaactcag222253354468433544727
262210tcttttcccttgcctacagcaggatgccgtcttttgggtta162023442594834425979
262211ggcagatggggtggaataaaccatggcgttaaacatgcag173543500821735008250
262212ttaaagccttgtgcgtgcatatgcgcatttttctgtccaa163443589931935899350
262213agcagcctgtggcagtgataaagcttcccgttccttgtca163843664837436648405
262214aggggaatgaagttcttgctcatgtccctggctcatctttga193973716911037169147
262215caccccttaccacccatgatggggaggacaaaccatctca191863807615638076193
262216tggccctaccaagagaggaacagccaattctgcaggtgtc213163901565639015697
262217gggaccaagcattgggtagaagggcagctaggtgcagaac213903983455739834598
262218agacctgctgtgggaggaagaggacacgtgtgtggacagg151794051726540517294
27CAP27Eggagcctcatacccacatccgatcacagtcagggcagcag201714893777348937812
27CAP27Sagaatgcgtgatgtgcaaggaggggattctggttcggttt1537633987613398790
272221taatgcccctgattcgctcttcggttcctggaaggatgtt1725043418544341887
272222gagccatggaaatgggagagaggtccgcccatcataagtg1828950148855014920
272223cctccagggctctaactggactgtgactcaggctggatgc1631558933635893394
272224ccaacaaccacacctcaggacacagatgcagctggtgaga1629867288616728892
272225gcacttgctcgtgtggagactctaaaggcaagcccaagga1625576660387666069
272226gggttcgctcgtcctctctagcggctagcacacagacaga1526984144208414449
272227ggagctgtcccaccagaaacagtttgagcaagggccacat1915986902798690316
272228tctttttgcccccactctgtaagagctcaatttcccatcagc1623792153039215334
272229ctgggctgcctgaatcaaatggaacacgttgcccattttt231981013798910138034
272230acgtgacccctgctcttcattcccatggagaaggtggttt182301085840710858442
272231acatgggaggatggacttgcgaggttccctgaggggtagg161941179293511792966
272232aggtgagaagctgggcagagcaaatgctggctctctcgtg183221272403812724073
272233gggtagccagaggcagtgactggtcctccttccagcattt202801357435613574395
272234aggcaaaggattggctcaagtgggctacttttgtgagcaa162161452179014521821
272235gcccatgccagaaatccttatcaccctcaccaaaactgga192521535318615353223
272236tccacactccctaaaatgagcacgggcttttgagattgaagc182811603607016036105
272237tggcagcttaggacagcaaacacttggatgggattctgga183681687744016877475
272238ggacactcagcccatagatgaacatgaaaccaagacccacgtt182041781930017819335
272239tgcagcccacttgaatacagagcaggttgatggggtcaaat173701857137218571405
272240tcattggatcatggcactaacctgcaagggatgaggcatgta152261889446718894496
272241cttctctgtggccaggaggtgctcttcctcccacaccatc193361966572519665762
272242gcaggcctccttcacctaaacccccacaccgactatcat223902056981220569855
272243tgggtccctggtagtcatccgcgagctccacctttgtttc202552155961921559658
272244tggaaatgtttcaaagggaaaagggggagaattttccaaagg183542236143822361473
272245acaaaggcatgtgcaagcaattaggccactccatccgact153272304375323043782
272246tgtttttgcaaacgtgctttttcaagtgaccagccagctcag213002403654724036588
272247tgggtgatgtgggctatttgaagccactcttccgaggttg172102473774424737777
272248tctgatgcaattgggacagagtcgaggctttgggtggagata152302543106925431098
272249tttgacattatcctttgggtcagattcccgcatccaaaagtc192012615970426159741
272250caactggtctccagctttccatggcacctgattgtgaatga153772705577927055808
272251ctgcccatctctgagtcgtgccaccctcatcagccatttt153592800396528003994
272252taatgaaaagccgcagagcattgtgcgcatcacagacttg133042857028628570311
272253tggaagcaagtgcagcattatcccacctctctggcaatct153342955171329551742
272254agtgagattttcgcccctcaagccaagagcacgtcacaag163793038533130385362
272255gggggagctctgaaaggtctttccctggcattatgggaga212343097472430974765
272256ttgacctcatggccctcataccctgtgtggaatctgggata163613184812031848151
272257tgaattctgggggaaaaatcaatgcccctttggaattgatg193533216372732163764
272258tttcaaaatgtgcacaccaaaagggggtggtttgaagaagtg173243287210432872137
272259gcaatgaaaagccaatgcaattctcatcctccaccctaacg172833387162633871659
272260gcccaaacaagtttgcctttcctgttcagctggcaatgag172483476225134762284
272261cctcagtggcattttcagacagcccttttctgctttcttcg163993572232635722357
272262gcagcccagggttctgtagtaatgttgctcgcatttgtgg222693646911936469162
272263gagggtgagccctctcttcagaccctgctccatcttgacc222733720582637205869
272264caagaggcagcacagacaggtgatctcaggcctcccttgt171753757716537577198
272265ttcgtcttgccaggtgtttgtgccactcctccagcctatt233443810837238108417
272266agtgccaatttggggataaatgaaaccttagaggtgctgaaa212703861872538618766
272267tcctgcatggttatgttcttgcgagttctccctgccttcacc183163897587038975905
272268tcctgcatttgcaatgaacaaactcccatctggtcaggtca183143970078939700824
272269tggtactttgggctgtcaacattgaggtggattcttgctcca183134068592740685962
272270ctagcctggagccaggtgtcgtggagcaacaggtgacgag192374162752341627560
272271ctggctggcttttcctatgggaaggagggcctgaacctct222814225502142255064
272272ttgatgccagaccacaacactgcactggggttgaattttg152944291779242917821
272273tgagcaggataacgccattccccatatcccaagcaggaaa202724368136543681404
272274gcccttctggtcctatgtggtggttctgagctctgccaaa181754455913744559172
272275tctgcatatccacgggtgagtgcaccaacccaattcacat173464515927445159307
272276ttctgtgattttcagggcataactcatgttcgggctccctac163044602511746025148
272277ggcatctgaggaggagtgctcatccaaggcatggagatga203284686950746869546
272278ccgagctgggcatagagattgcttaacgtggagcctgacc183684782674047826775
272279cacggcacaggaattcatctaataggggagtttgcagccaat192474863406848634105
28CAP28Ettgcaatatgcccattcaaaacagtttccatattgggcagga154004171226141712290
28CAP28Sattgggcaaccaaatccatcccagggggaaccttagctct1737635903863590419
282282cagtgcaatcatggcattcacaggattcttggggaagcag1936345352974535334
282283acagggaggtgtggagcactagcacccactgaagcactga2134455336825533723
282284tcactggagcagtccctgaaagcagggccatcagacctaa2429262043466204393
282285gaagggggacgtcaagagtgtgtcgtgaaatgccaaaagc1615169546866954717
282286tgcctatgggcctaccacatgctctctctgcccacctgat1934379486977948734
282287tgcgctcaagtaccgctaaacctggggtgaaggatgaaaa2136787748358774876
282288ccagcttgtagggctgttcccaaacaggtctggctggaca1523895958189595847
282289ggacaactgaaccccaaagccaaaagtgttgctcctgcaaa221481052947910529522
282290tccccatacctgttggttccgggggcttgctttaagctct153091141667711416706
282291gcctgaagcaaaacatcaaggtgggtggggtttctatttgg162211230892412308955
282292tgcaaacattgccttgttccaggcaataaaagccccacaa192891284568912845726
282293gggcactgggctctaacatcccccttgctgtccttctcac223261344187513441918
282294aggagaagagcccagggattgagtgtctgcctgtgagtttgg192841426815914268196
282295tcctccaaattgagcccctatggaccagatccgacagttg171911511935615119389
282296gcatttccaggcacattcaataaggctccccgtgactcaa153311605877716058806
282297aagcacccatagccaggagaaggccaaagtgcttggtgat183781673713616737171
282298aggggcatgtcaaggacagtgtgcccagatgacaccaaga191841754247817542515
282299tcctgccaaaagatggaggttgctgatgaaaacaccaatgc173931784162817841661
282300accctctattggcaggtggaggcatgagtcgacaaagcaa153131846052718460556
282301ccctgtgatgctgatttttgacctgaatctttggcctgtcc173351931078319310816
282302ttgacatcccctccgtatcctggttttcccctcactcttca192272022135220221389
282303ccaggttcacccatccatttaaggggccttgtgtacgtgt151352105425521054284
282304acaggaccatctgcaccttggctcctcaaagcaaccaacc153772184618621846215
282305acacaacacaccccacaaggtgtgcatgttgctgatgctc193972271365222713689
282306acaaaacacatgcccactgcgaggtcatgaggctgctttg163782370796623707997
282307ccacctgaggctaaatcctacctcccagagcaggctacacaa213152447753824477579
282308cctgacaccccctccaaatatgagcctttggaccacattg173792547036225470395
282309cactccaccgtgaccacaattccaagccagtttgtgctgt163692618853926188570
282310ttagctgtcgctggagagcatggtgggataaacagcagga162542717077527170806
282311ccgctaggcttttggacatcttgatgcaatgaggcaatcc153932799393427993963
282312gctacgtgcaaaagacaaccatacaagagccacgaggaagc163952876429228764323
282313accaagggcaccaaattcagtgatccttccaatgaagatgc192702962199429622031
282314caacaataacaggggcagagcacttttggccccctttccta152623056302330563052
282315ggggaagtgcaaagcaagtctgcagtgcctgttggtcttt163323151196931512000
282316gtcctgaaatggtgctgctgcaaaagagcatgcctgacca182843240380332403838
282317ttcttccatggcaagcagagtcgctttatggctccaggtt163413331489233314923
282318gacaaggccgcaaaattctcgattccatctccacccttgg183973419814334198178
282319tgaaactgcctaagggcacaggccaataggggcaataggt173643460567134605704
282320attgcgcggtgattttcaatattcaggtaagggcctgtcg173213558169335581726
282321tgccgaccaccaagtatgaggcacctcatccctcatctcc183493631082036310855
282322gtggcctgagatgtgaaacggactctgtggcccttggtct153983728170837281737
282323accctgatttcacgggacacggtcctcttacgccgtgact213193802642238026463
282324tcccatcattcccctttcacccccagacctgtgaggaaac163703902307039023101
282325cggattcttcttgggtctgcagggccaaagacaatctgga172243980394139803974
282326tggtgggttgagtcacttggggtgcccttgtaggaatgga173734025116240251195
282327gtgaccgcaagatgaaccaaccctagctttggcactcacc223774097517140975214
29CAP29Ecccactccccacttatggaaacaagagatggggtgcaggt152004446817744468206
29CAP29Stcagttgcaggagcagtaaccagtgggaactccaaccctga1833741015944101629
292330gctttgggccagtgagtctttggggtatagaaggccatgtg2026341877854187824
292331tcatttgttttcgtgtgtcctgccaaagagggcagcgattat1434550777955077822
292332tgcttaagattggccaaaacaatttgcatgatggggaaagtg2030559164215916460
292333tagtttgccaggagccaggtgagccaattgcttccaaagg2234868710336871076
292334cattgtgaatgcactctctccaccagcaccatagcgcaaata1821873527677352802
292335cagcctacgatgccttttcctgcagtggatggttttggag2019581491448149183
292336tgcagcacctgacagaggttcaactcggtgcacaaggaag1633891399319139962
292337cggaaaatgttgcctccaatcacgtgtggtagtggtttcca172791007725310077286
292338attcctcccttccccttgaagcttccctgtcctttgatgg212591104574711045788
292339acatgatgctggcacaggtcgggatggagcagaaaaggtg213291193043911930480
292340gtaggggcagagtggagcagttcatagctctgcctctttgga153921210544212105471
292341gtgaacctcttgcccctgtccccagtggggtatgttgctt163551306890113068932
292342gcctgagtctggggctagaaagcctgggacacaccaatct162771390023513900266
292343tcaggagtggggtagctggtcgcaaccaggaatacaacaca163581463123014631261
292344atgcatgaccctggaggaagtgcagcaatggcttgagttt193921508721915087256
292345gtgccgacagccaacataaatgctaatggcctgctttcag163651600297916003010
292346tgggcgtctgagcagataaagctactggcgtcagcagtgt203471695347916953518
292347tgcatttcaaagtccctttcaccaacccctcatgcttgaaca153311795145217951481
292348ccgcagccttaggactgaagcaagaaaaggcaccgaaga203901850103218501071
292349ccataaagcccttcaaatggagggttgaggacagcaacaca123581914689119146914
292350tgggagaaacgtagtgatgtggtgttcgcccaatttgtttatg164002003671120036742
292351cccaagattcaaactgttcaggtccgttttgctaagggattctc163852101827721018308
292352gggaaaggagtcctgcatttttgtgtgaaccctgatctgacc193242176320221763239
292353ccacagggagttctggcttcggggagatggaggctttctg153162266056722660596
292354gtcagccctggaccacctaccaactcccccaaaaatgagg242972364037823640425
292355ttgtgtctgcctcgagcattaaagcaggaaccgcagctta193262395111023951147
292356gccattccattgtcttcttgcaaaccactgtgggcaaatca161782486382724863858
292357ccccaactcaggtccattgtgagcacaccccatgttgcta213082564254325642584
292358accgtgctaggcagtgtcagtgcatttgagagaggcaaagc162592621460726214638
292359ttgaacagcacccctgtgactgccagggagatcaaagagc203992668711226687151
292360tgggcgctcctcttacaaatgggtctatttctggcgtgga193952767256427672601
292361tgcttggcttttggtcttgaattggctcccatcccttagc174002856961728569650
292362agcccacttcctggacttcagctggagcgtctggaaactt163592928940729289438
292363gccctggatccatcagagaggcctccacttgaacatgctg153653010742430107453
292364gcattcttcaaaaacagggtcagaccgggagtcctcaatcag203593099104930991088
292365caaccaggtagcaacatgcaagccaatatgttgctccagacc161373190494331904974
292366aggggcacattgcctagaaattccactctttgcaggctca203943280930032809339
292367cacgccaattaccaggtgagacctggcacttcgctgttct163683378569533785726
292368gcggtgtttgccctgtattagcttaatgccatgagggaaaa153233429429034294319
292369tgtgatgcctgaatgggagtccttatcctcccattggcttt153983523958235239611
292370tggcattcagtttcacaaagctcactggaagcagggatgag153413551174935511778
292371ttaaaggctggctggcaactttcaaaaatggccttgagga142823625406136254088
292372gggtgtggcagacagcttttgctggcagaaattcccaaga163263702190737021938
292373ccgcttaggctaggcatttttgcatgtggaacaaggtgtg161883795052637950557
292374accttggtggcatcacacagggactcctgctccactttgc162913890042138900452
292375cctctccttggccagaattgagaggggaggccaagagaaa211263955293339552974
292376gacgtcccaagggttcagaggattctcggtgccctgaaag193984053132140531358
292377ggcctcagctaagcatctcatcctgattttgcggtcacag183584131055741310592
292378ggggatctggtcatccaaaagcctcatgtcctccaaggtc152454206690042066929
292379ccagtgtcgaaaccccatttagcagattcctgctccaacc171854299230642992339
292380ccctctgaactgggttttcgtcagctggatggcctagaca153414363005043630079
30CAP30Etccctgctcctcttcctgtcgctgactttgaccccctgac172434297441042974443
30CAP30Stcagcttcccatttccttcaaaacaagcaatgactccacca1840031173263117361
302383tcgggtggaactgagatgtgtgtgggagctacagggcttt2226740918104091853
302384agggctgaagactgcctgagcacgctgccttatgctgttc2436749666284966675
302385agcatcccaaggtgtgaggtaaaggtgacccgaatgtggt1539058969415896970
302386tggcatccacttccttgagacaaagaaaggaagcccaaacc1539468213516821380
302387cccgcacatttcacttttcattggggaacccctaatgaga1827277349747735009
302388agtagtggctccagccgagacattcctggaaagaaggcaaa1634287299098729940
302389atgatccccaactggctttgccgtatgttgggtcaggaaga1533396412959641324
302390ctgctcagcgtgtgtgtgtcaggtggctccagccagataa161761062159410621625
302391tgctaagcccagcaccactaagtttgggctccacaggaaa213481142952511429566
302392atcgcctatacccagcaggagtgcctccacctcttgaacc181381197131111971346
302393tgaatggagaggggttatcacattgggcgcagaaagtaaggt173391263944912639482
302394gcaacagcatcctcttgtggtatcctcccagcagcctcag203601305288813052927
302395tggatcagatgggagctgttttgttggagaatttggcctctc173971387931413879347
302396tcccgcaaagacagaattgatgttgtgccccaggtattca152491457539714575426
302397tccagtttctttcctcatgtcaacttggaaagccaagcatga153361556779915567828
302398ccacatatgagggcccaaagtctgtgaactgcctcactcca173701582466715824700
302399ctcctgaaaacccagccattccatggagggtggtatgaca152941642451616424545
302400ctgcctgaagtctccctgctagatgatggccccatttgag163831720399217204023
302401agtcggaggcctgtgaatgtgacagctgtggctgctatgc163661777433417774365
302402tggtaatcaattgggctgtcccgaactgtgcattggctttt212301845256118452602
302403ttgcgattgtctggctcagtctcccactgcaacacgatct142481887995718879984
302404ggggctttggtaaggaaaagagcaggcattattgccagttc163521983253119832562
302405ggacccgtaagctggtaaacattctgcaaatgtgccggtag163742040199720402028
302406aagagatggggagctgcaagggcctaggagggagcaagaa202952139366721393706
302407tttcgaacacattggggagagctggccctaatttcagcat163992237781022377841
302408tgcctgaaaattttaccctcaaccaatcctggatgattttgaca203612328653923286578
302409acactgtggggcccagtaatcccaaaggtgaccacaatcc223972366519923665242
302410gaaagcatgcaatgttatttgctgcttgaatgggaggtaagga173812442366324423696
302411tccgagcaaagagaaaaagaggtggtccattccaatcagcag183772535523025355265
302412tgtctgctggtggcaaaactcagcctggtgctgtgttctc183732633723326337268
302413tcgatgccccagttaaaaccgcacttccgtggatccaaat183572724446427244499
302414agatagacggggctggatcactacgggaggctgtgggtag153472811251628112545
302415tgggtgaaaaatggaacagcttgtcttccgtgagccattg183932894770128947736
302416tgggagctcaattccatccttgaaattttgattcgggttgc183112989580929895844
302417ggtgttcccgtgatttggagctgacaggccagactgaacg163513015595030155981
302418agcatgggctttgcttgaatggcttatggtggcagacctc153423031992630319955
302419gggcgggggtatagacaactccagcaccaaatgatctgaca153323121830231218331
302420tccattaggggaggggaactcctctcaggcattgggtagg222973208315232083195
302421agccaggctttctgttccacttgggtctagggcaaggaaa153923298560032985629
302422gattgagggcgattttgaggatccgagaccacagagcaca183473394608733946122
302423ggggaccatggggtagaaaatgggtttccatttttgctca161693480800834808039
302424gcttggctttggtgaccattatcctggtagtgcccatgct163963554592735545958
302425gggaggcttcgttagggagtggatccagtggcgtctctct171423642066136420694
302426gcaccattcaggcatctcagggatgatcgggttgatccat152263735479937354828
302427ttgtcaagtggggcacgtagaaggcacctcttggactgga173433827336738273400
302428ggtgaagagcagcacaatggtgcagcatccgtctcttgat183043866045138660486
302429gaggggcgtaacagaagtggtgctcttcccgacatgctta182933958843939588474
302430gccttgctccttcttgcctagaagcccaccacagttcctc153964032730840327337
302431tgcaggctaaaaattgcgtagaatgcccatggaccaagagac163564128569541285726
302432catcgtttgtccccctcattggcctcagaaaggctttgaa193424181636641816403
302433ggcctttcttggcaattgagtggcaaatattggcagtgct193374233867542338712
31CAP31Egggaagggtgcagttctgtcagaggcgtaaccgccactaa223724108110041081143
31CAP31Stcacattgcccccatactaatcaaaggccatcttcaaaaagca1620045231204523151
312436caaatatcggggcaggaaaaaaacaccacagggagggttg1632453082975308328
312437aaacagcactggacaacaccaacaaggggctttctggagtg1536760308226030851
312438catgcctgctttctccctcttcttttctggaacaaccagtca1428766568436656870
312439tggatccaggatgttgggttaggcaaatcaggaatcgccta1531774047767404805
312440acaggtggcgacagaagtgagacggcagggctgagtaaag1635683147478314778
312441ttccatttgggcagctttcttgcagaatcacatggacacg1527486691128669141
312442cagaatgagacagaaccctccaagcaaaatgccacttgcaga1824393390519339086
312443agcttttcctttttggactcctggacaagacagctggaaaacaa1938098607689860805
312444ccgtctccatagaatcgcctatacccccagtgcacatcatc152491085069210850721
312445cttctccaccacctcccaacttggtcagcatctgggaattt162601179869311798724
312446ctccacctttggaggtcctgtgggcacttgatttgtccac163861232976512329796
312447tcctcagagatgggggaatcaggcagaaggtgagggaaca172861324721713247250
312448cggtgtcctcagaatttctcccaaggctgcttgaaagtgga192901400071914000756
312449tttcctttccacgactgcaacttcccaggttccagcaaac203501483056714830606
312450acccaaagcttcaggtgcatggaggggcagtttgagtgag153631555416315554192
312451gagcaaaactaagtggctcacgggaagctgccaaagcaagat162181634454316344574
312452ccaagactggtgctgaaacaaccagaggggcaagtggaata152961682115216821181
312453gcactttccacgaagcagaaaaccaccacaccatctgtgc223151771096417711007
312454atcattccaactcccgaccacaggtgtcccacgcttcata183771859288318592918
312455cagccagatcccaacaatcaagacttaccagccccacgaa152461873811418738143
312456tgatccaaaccgaactgctgtgacacctcatgttcctggat152301959679619596825
312457tcacacccattgtccccttagcaccagcctttgcttatcc212692045884420458885
312458cctgtgtctgccctcaacattgcacccagggagaaactgt201082082519520825234
312459ccatcagcaaatccaaagcatattggaggggagggtgttg172712161121221611245
312460ttgtcccaagtcataggtgctctggagaaagaatgagggaaaca202962214711622147155
312461caagcttggatgtggatggatcctgatttggcagtgttgc163622305886023058891
312462ggactttaggagacctgggacaatgccattccattcctttgc153792369205323692082
312463tcccctgttatgacccaagggatccagcatcgttccaaca183782448313224483167
312464ggtcattcaggccagcatctgattttcccacctcatcagaaa183782547699525477030
312465caaccaaggtgtgtgccctatgcctgggtattccactcaa151752631484526314874
312466tccacaagggtcaaaagttgaacttatcatcccgcatgcaca152392696423326964262
312467tcccacagccacatcgtagtttgggttctgctgatttcca203812744974927449788
312468caggacctgaggccatcctattccctgtcctgttaactccaa163812810378328103814
312469gccattcttactggggcaagcacagagtggaagggacagc173972894006228940095
312470actgggctcttgcctttgtcccccaaatataccgggcttt163762945087229450903
312471gggctcagctttggagaaaaccagcaggatttcatcagca182723019923130199266
312472ttccccaaacatgtgttttcatgctgatgtggttggctttc152973102784931027878
312473ccaggcaaaggctgagtttcgtaaacacacgccccagaca181763193812731938162
312474gggggtagagcaatgaagaggatttggagaggggagcaaca173833280456032804593
312475tgatgatggcaagccgtaagtgagcctcctccggaaatta233473377898833779033
312476tccctctttctggctgctttcaacccacagatccaaactcc231433468380534683850
312477ggcactcttaggcaccaaggttgctggagggcatctctct181893564657635646611
312478ggggtgatagcgaatggaaatgctccacgcacagagctac173883591547935915512
312479tgagagggcaacctgttgaggatcctgggggactcttgtg203223680210936802148
312480cctgcaactcactgcaaacctgattggggtgtgtgcaaag163793776809037768121
312481tttgcaggatgggaggttcttccaaccgatcatgacaagg152373873898738739016
312482agaccgggttttcccgtaaccagctttgcacttgggtcag173103960339339603426
312483tgtcccaacggagacacatccagcccgagtcccattagag163833979170639791737
312484tcccaggacttggtcctttccctaagcgtacggcagaaaa133564011509440115119
32CAP32Ettggtcattttgccttgctggccaaccaattcaagcacaa163274148877841488809
32CAP32Sggttcatttttgtttgctgtccgctctgtgccttgagggttc1738033693173369350
322487cttgcttgtgggcagtgtgtaaacgtctccacgctcagtg2231043567954356838
322488tgggccaaggttaaaagtgcggcaacccttagctgtttgg1738149970484997081
322489agcagccccaaataccaatgggcccaatgatcctctgact1426556778995677926
322490gggtcaaactctcctgagtggtcaatgcactgtgtccctttc1839066659516665986
322491ggcctatgattgagcctggaggacaactgtggtgggcttt1537575727277572756
322492tgccagtaggccagttaacaaggcacttttcagggagagga1531684289288428957
322493ccacaaagacccgaatggattttcccctgtctgcattgtc1518189934148993443
322494gggcataagggcaatcacattggtgagatccatttccagtg1940098551449855181
322495caactggagggctgacacagtcagggggagatcttccaaa202691068502710685066
322496tttttggaaactgacaggatgaccattgggtgaaaagttctgc193371163483511634872
322497gcacaccttgtcatgccattgaaacccagcgttcttcagg183681255329712553332
322498tttagcttcctttgccattgacaagccaccactgggagttc173101352408613524119
322499tgcatgaccaattgtagcacagggcatagcaacctggcaaat152581400728914007318
322500tgagttcccactggtgttgggaagcctttggccatggtag203021495487514954914
322501tctgggcaggtctgatttcccaggccatagtttttggatgg172441564103315641066
322502cccatagacgtgctctgtgcttgaaatgcctcagggtctatca122791659770916597732
322503ccacagtattgcagaggaaacgtgttccctaaggatttggcaat193551756395017563987
322504ccctgagacttctcttggctgtcaaaaagtctctggctccactt172921846263918462672
322505ttgaaatccccagttctccaatatgcaagcgatggcctatg153851940049119400520
322506gctggtggtgcctttcatctaacactgctttgcggtctca163712033872420338755
322507caattcagcggaaacatccagccacaggccattctgcta153192125921921259248
322508cttggagagcaaagggaacccttgtggcaggagcaagaga153372195820621958235
322509ggctcattcacaccctctccaggcttgccagttcacacaa163822246685022466881
322510ttttcttcaactgcccaaggaggattcaccaaaggctggaa152442259992822599957
322511ttgcttttggcatgctcattaatggatggctcactcttgga131862272702922727054
322512tggggactccacaggtctctccagggtagcccattttgaa203302370039923700438
322513cagggagggaggactatggaaagacattcctgctgccaga203692444523224445271
322514agcctgcactcccaatgttttatggtccctttggcctttg212002500906025009101
322515gcaatgtgagctgttgaaagagaggcttgagcctttgtgct172762573777725737810
322516cttcagtccaaacccccaagtcgtggagcaacttgaatgg152382664360626643635
322517tggaggaaggcaaacaaggttgctcaagccagaaaccaaa193392715732027157357
322518tggcctttccaaaaggaatctggggttctgtctgttggtg153412812195228121981
322519aacgggccccatatatgctttggggcttcttacacacttga193692887770928877746
322520gggtcattcaaggccaagagttgccacggaggtacttcaa192832960439629604433
322521tgttgagaaaaagccccaatcgcaagatgggagcaggaaag192803024031830240355
322522ctcccctcactggagctgattgacagcgatgcacagaaag143683065036730650394
322523agccactgaagtcagcctcattgcactccatgatgggaag182103158713731587172
322524gcaacctcttggcggtttagccccagaagcatacacatgg192923222806632228103
322525tgcataggtcatggggtcagggagttcccacactggctct172333312129133121324
322526ggatcaaaatccccaaagcatccacaaacccctgttgaaa173793404118734041220
322527accaccccgttggagtgtaaggccgtaggtacgtgtgtga162353500224935002280
322528ggacggggatctatggatgaaaatggccacaagagcaaca163903591700835917039
322529ggggagcctagggtctttcttcagcattttgcttttctgcat153953684768836847717
322530gctgctcagcctccttgttttcgttttgaatgaggccttt152703763996337639992
322531gccaaaatccaacccaacatggacgacttggactgctgtg201883825523038255269
322532atccccagtcaggtcatgctatgccaaaacatggatgctg182943905957539059610
322533tgcttcaaattccactggtctgccattccgatgcctcaagta203703999712639997165
322534tgcgtctcttaccccacagaacacactcccggaaaatgct182904088806340888098
33CAP33Egctgtcgtgggaaggagtcttggtgtgaggcactggtagg183133444003334440068
33CAP33Sttcaagtgggtctttggagaggcaggacggaatcatcaaca1539634056933405722
332537tcttgggtcaccagcaaatgctggggagcctcttcagtct1736843912074391240
332538catgtccagttgccaacacagtctgggagggctacccttt1521553701995370228
332539gccaactcaaagacaatgcaatgacatgaaaaccacaggtgaa1539861439636143992
332540cgctggctaagggtgcttacgcaaaaagccaacactgaacc1638771412217141252
332541tacctcctggagctgacgtgattggcctgctacgttccac1837480282978028332
332542acccggtctggattttccttggctagcatggggaaaaaga2332188510608851105
332543ttgggaagctgtcagatgtttctacgggctgtagccttttgg1638296468209646851
332544tgaactcggaaatcaagttggatttggcaagaaagaagggtga173651058171610581749
332545attggtgtccttgggtggacggtgaaagccagtcaacagc153021155877711558806
332546ttgaccagtgtgtgctgcattgggatgaggcttatttccaa163361245607512456106
332547ccaggcaccccataattgtctgtgcatgcagaaccagtga153241341567313415702
332548tttgcaaaaccaccacctgagaggtggtctgttggctgtg153331438397314384002
332549ttggcccaagccattaaatccccagtggaaatggttgtca173821518970615189739
332550cccatggaggaaagcagaagcccacccacctaactcatcc182881551145315511488
332551tggccaaaatccagtaaaagtgcccaagatatgcagggaaca152951647715316477182
332552gccatggggaatctaagagccttggtggggaaaggatgag173711728141517281448
332553atttaacccagtgcccgacaaccagggtcagggtttatgc72721736051117360524
332554caaacccctggctctggtaacccccaagctcacagtaaca153131795211417952143
332555atgccaagctgactgttccagaagtgcgaagtgcttgctg202161882876418828803
332556gggttgtggaaggaaactgcgaagtcggggaagagggact193131976474219764779
332557caagcctggcagtttcacagagcgcaaggaatgcaagaat193902061829020618327
332558tcttctttccatgcctgtggtggtcaaggaaaccatggtaaa173682122871521228748
332559acaatgacccttcgcgatcttttgggttgggtttttctgg162282210950222109533
332560ttgaccccggaaataaatgcatgagcgttgggacctgatt193502293746622937503
332561tcagttgcatgctcccagattgggtgctcagcagaagtgt172112390374323903776
332562cacaaggacaccaatagggacagcattcaatgtgtgtttccttc173272430336924303402
332563agcatcaaaaggggtcctcatcattgcccctagcctgttt193972528231325282350
332564tcgtgccctcctgaaaacttcaagtagctctccccctgct162542603528526035316
332565agagaagatgcatggtgcataaggccatgacaaaaccaggat201152657006626570105
332566aacggctaaatgcaaatgaagagcaccagaagggggtgataa141612733210827332135
332567caggagaggaaaaaccctatcaggcatttttgctttgtttgtaa162632785365327853684
332568tatgactggcacccattggatgcagcctgacagaggatgt172432828360128283634
332569caaggcccaggtacagaaggtgtcaccggcaggacattag203042909072629090765
332570ttgccattttggctgaacacctgcacgaaggcaaatcatc163742987931129879342
332571agggatgagagctggggtttggttcaaatgggggaaaaca163533075380830753839
332572aatggaaagatgggcaaacgaaagatggcagctcctctgc222683101609931016142
332573gccctggtcagacaagatgaatcatcacacggcctttcct141913123485931234886
332574atgaaatcggcacagcctttggaaccctgatcacgaggac123863213558132135604
332575caccccaagcactgtgtttttgatccttccagttcccaagc123883284900932849032
332576ccttgaccacgaccctctctggaaacctttctgccgtgag233283344171133441756
34CAP34Etgctctgcctaaatttggaactattgcaggtgtccagcaaga183364478173844781773
34CAP34Sgtgcctgaaaaggtgcacaggcacatgggtaacaccctca2137245352134535254
342579tcagctggttggagccactagtttccacacccttcgcttc1520754624615462490
342580cttgggcgatatttccctgatgtgtttcctctccgtgtgg2139162109976211038
342581attgcatcaggcagggttttctcggctcttttgtgggtct1813871998037199838
342582agaatgtctgctgcctgctgtctgagccacatctccagtga1532279122377912266
342583tccttcatctgttgctctcaagaaagcagaacacagtgggaca1634987836678783698
342584tgcctctttccccagctttacacattgggcctcttccatt2033597469579746996
342585ccagaagggtggtgacatgaggtctccccaacaccacatt163441058299010583021
342586catggacagatttgagctggacagggtgcagtgtggcttag172681149586411495897
342587ttggcctgggatctgaaagtaccctgctccccctctttac203841241500012415039
342588tgggggctggaaataagttggcagtcaaacatgggtctcg172921339852413398557
342589gctccatccaccttggtgttatgcaaatccaggcctctgt173421421458514214618
342590tgctttctccccctcgtaaacatcacaatgccccatcatc171731490919814909231
342591agaggccctcaaagcaactgtcccaaaacaccacatgagaa163111567858515678616
342592tgtgtcctccagggaaaaggccagaactgacctccccagt183661648084016480875
342593tgtaccctcccattcccttggcaataaaagcacttgggctaa183461747965817479693
342594gggaggcaaattgttcaagcggcacacaggtttgggattt173431821862018218653
342595ttctcctgcccctcacagattcgggctcagtgattcttga182261875112218751157
342596cacaccccagctgaagcatagttggttgtccaggggctta151461963393319633962
342597tggagcttcccaaccgtactccctgaacctctgccttttg183812058304520583080
342598cgctttgaacctggttttcccctcagccttcctcattcaga153782156333921563368
342599ttgaggcattgagtggtgctcgtgacctaacgtggagctg183652255490922554944
342600catagggaaggagggttggatttctcgggctgagttgaca181462350815923508194
342601gaggtcggcctgtgtctcttaacatttgccgcaccttctt153812389002323890052
342602ttttatggccccctcctcttttgaagactccatgccacct183842450924024509275
342603gcacaagaatggtaaggtgatgtgtgtttgtcttgcctccaa153912548267725482706
342604gctcagtgccccctcatttaggggagagcatttcctgcta221882637364026373683
342605ggcaggtatttgccaagcattgtgatccaaaagatcccctct172812736120727361240
342606aggcagggaatcttgggaattgtggaccacttcctttcca153812815480728154836
342607accttggacgaaaagggctagctgcaggttaggaccacct192862903606229036099
342608ggccaacagtggtaagcacacatattccccaccccagact153922982451429824543
342609ggcctgagtctatacctgcacattgacacgggggtcacacta203683081105130811090
342610gctgcctgcttatttgttccacaagcatagagcccatcacg163213144584631445877
342611gcttcccacgaaaaccactctgggatgtcttcaggacacg183663212767532127710
342612ttcctccttttcacacataccgtgacccagccagtctttgaa151243261472332614752
342613ccccctccttttctgttcagtttgtcctggagtcccgagat193833343529033435327
342614tcctgagttcttgcacacacatgggctgaaaaagggaacaa152813416486534164894
342615ttgcctctttctttgcaatctggctttgggctcggttaacat193993488289534882932
342616gtcagcccatcccaaacaatcagagcatatggtgcccagt172303569009035690123
342617tgtcttccagggtgtggagatccccaggaaagctgaaatg163953661960336619634
342618ccgcgagtgagctaaaaggtctcgaggcttatcggctttg153733738278037382809
342619ggcaaccacccagtttgttttgaggttaagaagcaagcctgt183623820366138203696
342620ccagagtagcttgggggaaatgccatttccatctctatcctt153403901947739019506
342621gttatggggatccgggtttttggcagagtgtgggatcaac162783979556139795592
342622gcatttggactttgggaggagtgcgtgtggcagagtatcc183754038760340387638
342623agcctggagcaaagagcatcttgtcccctggttttctctctc151454129994541299974
342624aagtctccgggcctttcttccagcacacgctttccttgtc182824206976742069802
342625tggagctctaacggagcaaaggagctggcatagcagagga163974300113143001162
342626gacccctccgtaatgacagcggcatccttcccataaagca153794383345443833483
35CAP35Etcaggctctctgtccatagcaaaggtgggaaacttggagca173672883845228838485
35CAP35Satggacccaggagagctcagggtctgacacgtcctttttgg1529637810963781125
352629ccacgtgcgcaagaataaaacccccgatgatgagtgattt1836147399864740021
352630atgacggctcctctttggaacgaagggacctaaagcgaga1939356707805670817
352631actctgctgccctcaagtcctcgacaccgtcttggttttg1715065952326595265
352632ccagacagcaggcaaatcaggcccaccatgaaacacacac1614674043687404399
352633ctatgggccgagagagttgggaattgccttcttggttgctg2430182204178220464
352634gggtgaaaggggtcaaaacacgttgccatacacagttccaa1916491972169197253
352635gggggttcgaagagtttttggggctcctggaggaaaagtt1738499574029957435
352636caggttccctctgtcggttcacaaactcgaccagccctgt193051070312810703165
352637tcatgggctgtggaacaaagaacccactgcatttgggact171981149141511491448
352638tcaaaattggtgttcgtcaggtgtgttgctacccaacaatga163921240880112408832
352639aggcatgtgggtgacttgtgtggtatgtgccgagatccag183941321256613212601
352640cctgcagctatctccccatcaaccaaaaattcccccaacg161181413864614138677
352641acccgtaggtggggtaaaggcgcgttatccatcatcacaga233661501531415015359
352642ccgcgaaattcaaacagacaacggactgcagaggaaggag183751580278015802815
352643ctcctgggaaggagggaacttccccattgttggaacacaa193501672061316720650
352644ctaatgggagggctggtgaagcctgaaagagcaaggcagt193391758861417588651
352645ttcaaatcgaggggaaggtcatgtcgaaaagcctcctcca163531849604318496074
352646atgccagggaacactccactcccaaagctcgaaggacaac152581922653019226559
352647ttacagctttcggtggctgagatgtgccagttttccacct183752020823320208268
352648tggggaaagtgtgctgaagaagatggctgaaatgcccagt151912109670821096737
352649gggagaactgacagctgatggggccacagcaatagaaagca154002198895521988984
352650agccccttttcttccactcaatgagcaacccccagctct213962253031722530358
352651ggcatatgctctggttgcagagcaacgagcttcaatctgct233372351199523512040
352652tggctgctgagcatggtatcggatgcatctaagttcgtggaa173612439104524391078
352653cctcccactgtgtagcaccactgcccatctgctcattcag162632534072925340760
352654gcaaatgggcttccagagtcgtggcctgagccttatcacc173702626112826261161
352655ctcaagctctctgtcccaatgtgctaagtttcccagacatcca183092706241327062448
352656tttccctaaggcccgtttttctgcccttcaggtcatgtca202282805448028054519
36CAP36Ecctgaaatggctggaaacgctcccacctgctcagtgatg204003314596533146004
36CAP36Scatggagaatgatcagctcagaaaccaaggcagcagaagctc1935838459123845949
362659ctgctgcagatggaaggagaaagagcctcagtttctggttgg1927348128464812883
362660ggggtaggggacttccatgttgcactcaatcctgcaacct2137358038115803852
362661tttgggcattttcattgttgaattccccatgctcaaacagg2737768030426803095
362662gctgctgagtgctgccataacctggacaacatcccttggt1821472848887284923
362663gtaagcccatgcagctcaaaataatcccagggggctgttt2127281571178157158
362664ccaggcagggctcacttaactgggattgcttctgggaaga2031491422019142240
362665acgatcggccaatgacttcttgcccattgttgtttgaagc163871009685810096889
362666tgggtctaggtgcctcgaatcatgccacagcctgtcattt203161069123610691275
362667tatggcgatgagcatgcaggcccctagaatacagggtgga202911160396511604004
362668tcgtgtttaaggcagcgtgtgtccaggcttctctgcaggt162771248841712488448
362669ttttggcaccctcgtatgtgttgtggaccatccgagacac152761324339213243421
362670tggtagggtgtgtggcagagtcctggtaggccatgagacc183961409190714091942
362671tggagtgaactgaggccagatcatgcaattctcaggatgaaa163161496010514960136
362672aggctgcaatgattggtgtgtgaacttccctgcttgatgg161871583285415832885
362673ccgtcaactaccatgccaaagaggtggctctgtcctccac163951624400116244032
362674attcactggctctcggggtaatgctgtggccagatgtcaa182811676532216765357
362675gcaatgttcacattccctcctgcctgggcagagaagagcta133361687571216875737
362676accctgaattggtggacaggtccagctcctttgctgactg153921785758817857617
362677tgcctaccgtccaactccttgcatcaacagccgttagcac173931862551718625550
362678ccaatcggggtcactttcatattggcattccccatgtagc252761910025719100306
362679aattacctcgggaaggcacatcctgtgactggctcatgct203171993655519936594
362680gccatgcatctcatctccaagcaaaagggggctgtagaaa203702093383620933875
362681cgcgagcgacagagtagagagaggagggagcgtttctgtg173872153247721532510
362682gaaagtgtgccactgggtacaatttccacctagcccattctga141682218601422186041
362683ttcgggttccaactcagagcctgcaaggcaaagagaccaa213102305006023050101
362684ggcgtgggagaaactctttggaaggtgcggtagctcaagg182122392894323928978
362685cagaaggctgagaagggatcagccagttcttgtctgctcca213322491030824910349
362686tccactgcaagaatatgctcaacccatgactcaacctaggaacc173582584730925847342
362687aaggcatgcaaccaaccatatccactaaggggagggtaagc173532676418126764214
362688gggatttgttttgctcggagtaccgtggctctcttccaaaa163862766427527664306
362689cagggatggggtagttggaatcgtgtgtgtgttggtcagg152852780345627803485
362690acgcccaaaacaggactcatttgggctggaccaaagaaaa163882849276028492791
362691ggaagcaataaagggcaaagtgtttcgggagagtagggcaaa162802947575029475781
362692caaactgcctttggcatgagcaaaatccatggcccatttt203643034651930346558
362693tgcaaccccttccatcaatacacggataagggatgcttcttt184003130277631302811
362694ggagtttcaggcgcaaaaagaatcattctgccctccctga192573204669532046732
362695tctgtgcctgccatgtatcctgagcctggatgtccctttt161133288428732884318
37CAP37Etgcatcttttcatccacggtagcgtgtctgctttccacttg163563384406233844093
37CAP37Saccaggaaggcatctgctgttcgtggctctcactcaagga2334436814183681463
372698cgtatttgcaatctctccctgtcccctcatatgatccagtgtca1818943747624374797
372699agagtcggtgcccagttcatagatgttctgtgggggcagt1836353635855363620
372700ggcacctgttgggactgttttcccctcagttccatccact1813955653845565419
372701gggcagactgctcctcacttccaagagaccctttgcacct1933665336716533708
372702ccaggttgtccatgatttggtccattgttttgttttcattgc1538774416987441727
372703gggaatcgttcactggaagcatattcctccctgccacagc1637983587178358748
372704atgccatgggctttgcttaccattggccctatgagactgac1519692497659249794
372705tgtgcctatggctgctgactcctcgtgtgaaggcaaacac183841019924110199276
372706catcagctaggcatctgcattccttttcttctgggctggag172361097230410972337
372707tcctggtcaaccagagcagattacgggttgcctctgtgaa223071189032411890367
372708actgcctccctgatgctgttcattcagttgggatccagca172721276520612765239
372709aaacagaggactgccccaaattgccttccagctgattcatt173471352783813527871
372710tcgagtcccaaagagggagatctccctacccccagctgta192541416429614164333
372711gttgtgggggctaccttgagtggttagcactggtggtgattt172051477519614775229
372712ctcctgcactccatgctcacggaagctgggaggaatgttg173771559710115597134
372713tgccacagagctttctcacaaaacttcgatgcacggtgaaa191501644551516445552
372714gaaaccctggcaactccatctgagggttgtgggtacatgg171311741646317416496
372715gcgatcatggggtgatttttgagtgagggtgggaaacagg191551830947718309514
372716ccacgtgacccacattcctagcgcagagcagcagagataa152421886680618866835
372717gagatctcgagcaggttgcatccccaaaacatgcaacaaaa192921958530619585343
372718cgtgccgctacaaatctctgctgatgcactgtggggagag193292058219420582231
372719tcctttgtaggccctgcactagcacttgggtttggcaagt173972155924021559273
372720taggccacttcgctttgtgaatcctgcggtcctttcttca203372236118122361220
372721ggaaatctgccagtgccttttcatggggtctctgttacttca163962326459423264625
372722attatccgggaagcctgtgacctgtgccaccaatgacact181432364778323647818
372723tccaccttgaagaacctttgcaccttcaccctgatgaattagc152602442112624421155
372724atggcccagtaagtgcctgtgcactggcagcaagtcaagt163132475735824757389
372725ggggccagccaaataaaagtctggcagcctgtgagctaaa141752522346225223489
372726tccacagcaggagctgaaaaggtcccatccgtccttcata201972619782726197866
372727ctcgttcacttggggagaccgctggcctatcttaaatgtgct153472700100127001030
372728acgccagtctcagctcagtgggtcaaggatgaggcaggtc193112771871227718749
372729cccgaaagccttacaagaggccgggtcagtttggattgtt193412865124428651281
372730gcacccctctgcctgatttactaccagcatcatggcaacc153712959577429595803
372731agggccacaaggggtagaattgcactgaaggttgggagaa213343030529530305336
372732gaagcccactattgcacaagcagcagaagcttcccatggac173713126886131268894
372733aagccacctgcttgagcttcgtgcccacccaccactattt151743183691331836942
372734cattttcccaactgggttgacctgacaattgaagggttgg173543248434932484382
372735gaggtctgttcccgttgaccggacactgacttgcgaccac152703320431333204342
38CAP38Ettttaaatgccaggggcttgacgcataagcgtgttcatgg193582638895526388992
38CAP38Scctcgaacagcagggtaaggcgcttgagaggcttgacaga1636138391493839180
382738gcacacgatctcggtgagagccgtgaactggaatgcaaaa1539544920324492061
382739gacgctggttgtttggttcaaactgtctccggagcctcac1631452973195297350
382740tctctgctgtgtgctcatgcaagcatgagtgggtcgattg2121162278986227939
382741ccttcacctcctcttgacctttgcacacaggcagggtacaga1525571424057142434
382742gcttggacaacatgcctgaactcctaggctgcggacttgt2029080735018073540
382743cggaaggctcatctccaagattgccttttccagagccaat1539187640788764107
382744ccgtagaacctttggaaggacacaggattctaggcccccaaa1839193181979318232
382745tgatgggcagggtttactttttggaaaatctggaatgatgctg2040099285589928597
382746ttggcttcgtgctcttcctttggatctgtccctctcagca153991075904710759076
382747cagtttggtgaagggtgcaagctggcctagctgtatgtcca173011098753310987566
382748gccctcatccaacacactcatcctgcaggttttcattcttga152001190677511906804
382749tttcggtcccttctgctttggcaatgggagggtctgtctc163731220171412201745
382750tcttcgaaatctgcctgtgctcaatgtggccaattaatcca162511306419613064227
382751tttgatcaatgtggccctgaagccatggtccctgtatggt153751398821613988245
382752aaggacagaatttggcacacacctgagtccgtgttccatca163691493105714931088
382753gaccccatccaagatgaagctggccatcagtttgaccaag153081588158415881613
382754ccacaggactcatgggaacaagcagctggtggtcaagtca163071661803616618067
382755gtgcatcgtgtggttgacctttccgggaacctttttgaga163631730444117304472
382756cagcagttcatcgccttgaccagcctccagagaaactgcat153631808914718089176
382757tgcccaaggaggttttgtcttcccacatctccgaggactt202701853813218538171
382758tccaggaaccaactgtgtcggagcaccatgcctcactcac143431856326218563289
382759gccaaccctacagaccaagcagggccaggagttgagcata132291949930719499332
382760ctccctaaccgtcccacaaaggcgtttacggactcctctg151562031251820312547
382761aaagctggtgctctgccaattcaaggctcctcacctctcc183442106701521067050
382762agtgcccaaaatgcctcagtcaggtgctctcagggagctt162972163240121632432
382763tgctcagagagtgcgagagggataccaaaggccaccctca163902256106322561094
382764aatcctccactgctgccattaataatgccggatggaccac163142347489823474929
382765gaatttggggccgtgtagaacgctcacacctgcataaacc153442419305624193085
382766gctcagcagggtctgctacattttcccccggaaacaaag163612500884325008874
382767gactgagcttcctcgggagaggtgacctttgcctggtagc181572586535825865393